CleftGeneDB-Search

Gene: TAPT1

Basic information

Tag	Content
Uniprot ID	Q6NXT6; Q8N2S3; Q9NZK9;
Entrez ID	202018
Genbank protein ID	BAC11022.1; EAW92754.1; AAH66899.1; AAF28308.1;
Genbank nucleotide ID	NM_153365.2
Ensembl protein ID	ENSP00000385347
Ensembl nucleotide ID	ENSG00000169762
Gene name	Transmembrane anterior posterior transformation protein 1 homolog
Gene symbol	TAPT1
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type
Developmental stage
Data sources	Homology search
Reference
Functional description	Plays a role in primary cilia formation (PubMed:26365339). May act as a downstream effector of HOXC8 possibly by transducing or transmitting extracellular information required for axial skeletal patterning during development (By similarity). May be involved in cartilage and bone development (By similarity). May play a role in the differentiation of cranial neural crest cells (By similarity).
Sequence	MAGVGDAAAP GEGGGGGVDG PQRDGRGEAE QPGGSGGQGP PPAPQLTETL GFYESDRRRE 60 RRRGRTELSL LRFLSAELTR GYFLEHNEAK YTERRERVYT CLRIPRELEK LMVFGIFLCL 120 DAFLYVFTLL PLRVFLALFR LLTLPCYGLR DRRLLQPAQV CDILKGVILV ICYFMMHYVD 180 YSMMYHLIRG QSVIKLYIIY NMLEVADRLF SSFGQDILDA LYWTATEPKE RKRAHIGVIP 240 HFFMAVLYVF LHAILIMVQA TTLNVAFNSH NKSLLTIMMS NNFVEIKGSV FKKFEKNNLF 300 QMSNSDIKER FTNYVLLLIV CLRNMEQFSW NPDHLWVLFP DVCMVIASEI AVDIVKHAFI 360 TKFNDITADV YSEYRASLAF DLVSSRQKNA YTDYSDSVAR RMGFIPLPLA VLLIRVVTSS 420 IKVQGILSYA CVILFYFGLI SLKVLNSIVL LGKSCQYVKE AKMEEKLSNP PATCTPGKPS 480 SKSQNKCKPS QGLSTEENLS ASITKQPIHQ KENIIPLLVT SNSDQFLTTP DGDEKDITQD 540 NSELKHRSSK KDLLEIDRFT ICGNRID 567

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

There is no related protein structure for this gene.

Protein disorder information

Orthologous information

Relation	Gene symbol	Entrez ID	UniProt ID	Cleft type	Species	Evidence	Details
1:1 ortholog	TAPT1		A0A5F4CM65		Canis lupus familiaris	Prediction	More>>
1:1 ortholog	TAPT1		A0A452EHE5		Capra hircus	Prediction	More>>
1:1 ortholog	TAPT1	202018	Q6NXT6		Homo sapiens	Prediction	More>>
1:1 ortholog	Tapt1	231225	Q4VBD2	CPO	Mus musculus	Publication	More>>
1:1 ortholog	TAPT1		H2RC85		Pan troglodytes	Prediction	More>>
1:1 ortholog	TAPT1		A0A287A5J1		Sus scrofa	Prediction	More>>
1:1 ortholog	Tapt1		D4A533		Rattus norvegicus	Prediction	More>>

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
rs1231609799	p.Ala2Thr	missense variant	-	NC_000004.12:g.16226454C>T	TOPMed
rs1302327888	p.Ala2Val	missense variant	-	NC_000004.12:g.16226453G>A	TOPMed
rs1230002834	p.Gly3Ser	missense variant	-	NC_000004.12:g.16226451C>T	TOPMed
rs966120453	p.Gly5Arg	missense variant	-	NC_000004.12:g.16226445C>G	TOPMed,gnomAD
rs1268967150	p.Ala7Gly	missense variant	-	NC_000004.12:g.16226438G>C	gnomAD
rs1254947968	p.Ala8Val	missense variant	-	NC_000004.12:g.16226435G>A	TOPMed
rs1367004171	p.Ala8Ser	missense variant	-	NC_000004.12:g.16226436C>A	TOPMed
rs1467246472	p.Ala9Thr	missense variant	-	NC_000004.12:g.16226433C>T	TOPMed
rs1193091078	p.Pro10Leu	missense variant	-	NC_000004.12:g.16226429G>A	TOPMed
rs1343254084	p.Gly11Arg	missense variant	-	NC_000004.12:g.16226427C>T	TOPMed,gnomAD
rs1371169744	p.Glu12Lys	missense variant	-	NC_000004.12:g.16226424C>T	TOPMed
rs893097016	p.Gly15Cys	missense variant	-	NC_000004.12:g.16226415C>A	TOPMed
rs893097016	p.Gly15Ser	missense variant	-	NC_000004.12:g.16226415C>T	TOPMed
rs1438001487	p.Gly15Asp	missense variant	-	NC_000004.12:g.16226414C>T	TOPMed
rs1055155801	p.Gly17Asp	missense variant	-	NC_000004.12:g.16226408C>T	TOPMed
rs1001779408	p.Pro21Ser	missense variant	-	NC_000004.12:g.16226397G>A	TOPMed
rs1350671190	p.Asp24Glu	missense variant	-	NC_000004.12:g.16226386G>C	TOPMed,gnomAD
rs1275520193	p.Asp24Asn	missense variant	-	NC_000004.12:g.16226388C>T	TOPMed
rs1296116106	p.Gly25Ser	missense variant	-	NC_000004.12:g.16226385C>T	TOPMed,gnomAD
rs1248754943	p.Arg26Cys	missense variant	-	NC_000004.12:g.16226382G>A	TOPMed
rs906057894	p.Gly27Ala	missense variant	-	NC_000004.12:g.16226378C>G	TOPMed
rs1433688479	p.Ala29Thr	missense variant	-	NC_000004.12:g.16226373C>T	gnomAD
rs1365348243	p.Ala29Gly	missense variant	-	NC_000004.12:g.16226372G>C	TOPMed,gnomAD
rs1365348243	p.Ala29Val	missense variant	-	NC_000004.12:g.16226372G>A	TOPMed,gnomAD
rs1322095852	p.Glu30Lys	missense variant	-	NC_000004.12:g.16226370C>T	TOPMed,gnomAD
rs1188396841	p.Gly33Arg	missense variant	-	NC_000004.12:g.16226361C>G	TOPMed
rs1276421427	p.Gly34Val	missense variant	-	NC_000004.12:g.16226357C>A	TOPMed,gnomAD
rs1045913560	p.Gly34Ser	missense variant	-	NC_000004.12:g.16226358C>T	TOPMed,gnomAD
rs1276421427	p.Gly34Asp	missense variant	-	NC_000004.12:g.16226357C>T	TOPMed,gnomAD
rs1455007644	p.Ser35Cys	missense variant	-	NC_000004.12:g.16226355T>A	TOPMed
rs1401162402	p.Gly36Cys	missense variant	-	NC_000004.12:g.16226352C>A	TOPMed,gnomAD
rs918344966	p.Gly39Arg	missense variant	-	NC_000004.12:g.16226343C>G	TOPMed,gnomAD
rs941024143	p.Pro40Ala	missense variant	-	NC_000004.12:g.16226340G>C	TOPMed
rs941024143	p.Pro40Ser	missense variant	-	NC_000004.12:g.16226340G>A	TOPMed
rs1260296379	p.Pro44Leu	missense variant	-	NC_000004.12:g.16226327G>A	TOPMed
rs1410509737	p.Gln45Arg	missense variant	-	NC_000004.12:g.16226324T>C	gnomAD
rs28384238	p.Leu46Arg	missense variant	-	NC_000004.12:g.16226321A>C	1000Genomes,ExAC,TOPMed,gnomAD
rs1211278442	p.Thr49Arg	missense variant	-	NC_000004.12:g.16226312G>C	TOPMed
rs1259394520	p.Leu50Arg	missense variant	-	NC_000004.12:g.16226309A>C	TOPMed
rs1474168754	p.Glu54Ter	stop gained	-	NC_000004.12:g.16226298C>A	TOPMed
rs1474168754	p.Glu54Gln	missense variant	-	NC_000004.12:g.16226298C>G	TOPMed
rs766333220	p.Ser55Arg	missense variant	-	NC_000004.12:g.16226293G>C	ExAC,TOPMed,gnomAD
rs766333220	p.Ser55Arg	missense variant	-	NC_000004.12:g.16226293G>T	ExAC,TOPMed,gnomAD
rs1414419245	p.Asp56Tyr	missense variant	-	NC_000004.12:g.16226292C>A	gnomAD
rs1248746825	p.Arg57Gln	missense variant	-	NC_000004.12:g.16226288C>T	TOPMed,gnomAD
rs1248746825	p.Arg57Leu	missense variant	-	NC_000004.12:g.16226288C>A	TOPMed,gnomAD
rs760816916	p.Glu60Lys	missense variant	-	NC_000004.12:g.16226280C>T	ExAC
rs1174643285	p.Arg62Cys	missense variant	-	NC_000004.12:g.16226274G>A	gnomAD
rs1410757222	p.Arg65His	missense variant	-	NC_000004.12:g.16226264C>T	gnomAD
rs374769392	p.Glu67Asp	missense variant	-	NC_000004.12:g.16213897C>G	ESP,ExAC,TOPMed,gnomAD
rs1344187452	p.Glu67Lys	missense variant	-	NC_000004.12:g.16226259C>T	TOPMed
NCI-TCGA novel	p.Leu71Ser	missense variant	-	NC_000004.12:g.16213886A>G	NCI-TCGA
rs779100798	p.Ser75Ile	missense variant	-	NC_000004.12:g.16213874C>A	ExAC,gnomAD
rs1397539962	p.Ser75Gly	missense variant	-	NC_000004.12:g.16213875T>C	gnomAD
rs1368505552	p.Ala76Thr	missense variant	-	NC_000004.12:g.16213872C>T	gnomAD
rs996274814	p.Leu78Val	missense variant	-	NC_000004.12:g.16213866G>C	TOPMed,gnomAD
rs900553486	p.Gly81Glu	missense variant	-	NC_000004.12:g.16213856C>T	TOPMed,gnomAD
rs900553486	p.Gly81Val	missense variant	-	NC_000004.12:g.16213856C>A	TOPMed,gnomAD
rs755405035	p.Tyr82Cys	missense variant	-	NC_000004.12:g.16213853T>C	ExAC,gnomAD
rs749694807	p.Glu85Lys	missense variant	-	NC_000004.12:g.16213845C>T	ExAC
rs780629454	p.His86Arg	missense variant	-	NC_000004.12:g.16213841T>C	ExAC,gnomAD
NCI-TCGA novel	p.Asn87His	missense variant	-	NC_000004.12:g.16213839T>G	NCI-TCGA
rs1286405219	p.Asn87Asp	missense variant	-	NC_000004.12:g.16213839T>C	gnomAD
rs1429259248	p.Glu88Lys	missense variant	-	NC_000004.12:g.16213836C>T	TOPMed,gnomAD
rs756174108	p.Lys90Arg	missense variant	-	NC_000004.12:g.16213829T>C	ExAC,TOPMed,gnomAD
rs767696888	p.Glu93Lys	missense variant	-	NC_000004.12:g.16213821C>T	ExAC,gnomAD
NCI-TCGA novel	p.Glu93CysPheSerTerUnkUnk	frameshift	-	NC_000004.12:g.16213795_16213822ACAAGTGTATACTCTTTCTCTTCTTTCT>-	NCI-TCGA
rs1161914663	p.Val98Ile	missense variant	-	NC_000004.12:g.16213806C>T	TOPMed
rs757526769	p.Thr100Ser	missense variant	-	NC_000004.12:g.16213799G>C	ExAC,gnomAD
rs1415349182	p.Arg103Ter	stop gained	-	NC_000004.12:g.16213791G>A	gnomAD
rs372007118	p.Arg103Gln	missense variant	-	NC_000004.12:g.16213790C>T	ESP,ExAC,TOPMed,gnomAD
rs541894051	p.Glu107Lys	missense variant	-	NC_000004.12:g.16213779C>T	TOPMed
rs187246858	p.Ile116Leu	missense variant	-	NC_000004.12:g.16202565T>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
COSM1052805	p.Phe117Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.16202562A>C	NCI-TCGA Cosmic
rs1369107846	p.Cys119Arg	missense variant	-	NC_000004.12:g.16202556A>G	TOPMed
rs1010481444	p.Leu120Arg	missense variant	-	NC_000004.12:g.16202552A>C	TOPMed
rs758122967	p.Ala122Val	missense variant	-	NC_000004.12:g.16202546G>A	ExAC,TOPMed,gnomAD
rs1310756420	p.Ala122Thr	missense variant	-	NC_000004.12:g.16202547C>T	gnomAD
rs1256018478	p.Phe123Cys	missense variant	-	NC_000004.12:g.16202543A>C	TOPMed
NCI-TCGA novel	p.Leu124CysPheSerTerUnk	frameshift	-	NC_000004.12:g.16202540A>-	NCI-TCGA
rs1277468438	p.Val126Gly	missense variant	-	NC_000004.12:g.16202534A>C	TOPMed,gnomAD
rs1369257099	p.Val126Met	missense variant	-	NC_000004.12:g.16202535C>T	gnomAD
rs1408682230	p.Thr128Ser	missense variant	-	NC_000004.12:g.16202528G>C	gnomAD
rs905198954	p.Arg133Lys	missense variant	-	NC_000004.12:g.16202513C>T	TOPMed
rs183054243	p.Phe135Ser	missense variant	-	NC_000004.12:g.16202507A>G	1000Genomes,ExAC,TOPMed,gnomAD
rs1416012632	p.Ala137Ser	missense variant	-	NC_000004.12:g.16202502C>A	gnomAD
rs1180293674	p.Leu138Pro	missense variant	-	NC_000004.12:g.16202498A>G	gnomAD
rs575693373	p.Arg140Trp	missense variant	-	NC_000004.12:g.16202493T>A	1000Genomes,ExAC,gnomAD
rs1184914211	p.Leu141Pro	missense variant	-	NC_000004.12:g.16202489A>G	gnomAD
rs370237480	p.Leu142Phe	missense variant	-	NC_000004.12:g.16202487G>A	ESP,ExAC,TOPMed,gnomAD
rs1348191899	p.Thr143Ser	missense variant	-	NC_000004.12:g.16202483G>C	TOPMed
NCI-TCGA novel	p.Thr143Ala	missense variant	-	NC_000004.12:g.16202484T>C	NCI-TCGA
rs202111552	p.Pro145Thr	missense variant	-	NC_000004.12:g.16202478G>T	ExAC,gnomAD
rs377747758	p.Pro145Leu	missense variant	-	NC_000004.12:g.16202477G>A	ESP,ExAC,TOPMed,gnomAD
rs779096019	p.Cys146Ser	missense variant	-	NC_000004.12:g.16202474C>G	TOPMed,gnomAD
rs779096019	p.Cys146Tyr	missense variant	-	NC_000004.12:g.16202474C>T	TOPMed,gnomAD
rs1181905607	p.Gly148Ala	missense variant	-	NC_000004.12:g.16202468C>G	gnomAD
rs1385427499	p.Leu149Ser	missense variant	-	NC_000004.12:g.16202465A>G	TOPMed
rs1426680333	p.Arg153Cys	missense variant	-	NC_000004.12:g.16191516G>A	gnomAD
rs1204849540	p.Leu155Pro	missense variant	-	NC_000004.12:g.16191509A>G	TOPMed
rs1369235854	p.Val160Met	missense variant	-	NC_000004.12:g.16191495C>T	gnomAD
rs1168592093	p.Asp162Glu	missense variant	-	NC_000004.12:g.16191487G>C	gnomAD
rs75638932	p.Gly166Cys	missense variant	-	NC_000004.12:g.16191477C>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1392436533	p.Val167Ala	missense variant	-	NC_000004.12:g.16191473A>G	gnomAD
rs1196255522	p.Leu169Phe	missense variant	-	NC_000004.12:g.16191466C>A	gnomAD
rs778997117	p.Val170Leu	missense variant	-	NC_000004.12:g.16191465C>A	ExAC,TOPMed,gnomAD
rs1192416407	p.Ile171Val	missense variant	-	NC_000004.12:g.16191462T>C	gnomAD
rs749993401	p.Tyr173Cys	missense variant	-	NC_000004.12:g.16191455T>C	ExAC,gnomAD
rs1205798642	p.Met175Val	missense variant	-	NC_000004.12:g.16191450T>C	gnomAD
rs755038455	p.Met176Ile	missense variant	-	NC_000004.12:g.16191445C>A	gnomAD
rs371262145	p.His177Gln	missense variant	-	NC_000004.12:g.16191442G>C	ESP,ExAC,TOPMed,gnomAD
rs767058422	p.His177Arg	missense variant	-	NC_000004.12:g.16191443T>C	ExAC,gnomAD
rs376659280	p.Tyr178Cys	missense variant	-	NC_000004.12:g.16191440T>C	ESP,ExAC,TOPMed,gnomAD
rs759948456	p.Val179Ile	missense variant	-	NC_000004.12:g.16191438C>T	ExAC,gnomAD
NCI-TCGA novel	p.Asp180Asn	missense variant	-	NC_000004.12:g.16191435C>T	NCI-TCGA
rs568245730	p.Tyr181Asn	missense variant	-	NC_000004.12:g.16191432A>T	TOPMed,gnomAD
rs777114921	p.Tyr181Cys	missense variant	-	NC_000004.12:g.16191431T>C	ExAC,gnomAD
rs370646247	p.Tyr185Asn	missense variant	-	NC_000004.12:g.16191420A>T	ESP,TOPMed
rs771467593	p.His186Tyr	missense variant	-	NC_000004.12:g.16191417G>A	ExAC,gnomAD
rs1171159044	p.Gly190Glu	missense variant	-	NC_000004.12:g.16191404C>T	gnomAD
rs1428760851	p.Gln191Glu	missense variant	-	NC_000004.12:g.16191402G>C	TOPMed
NCI-TCGA novel	p.Ser192Pro	missense variant	-	NC_000004.12:g.16191399A>G	NCI-TCGA
rs777859476	p.Val193Phe	missense variant	-	NC_000004.12:g.16191396C>A	ExAC,TOPMed,gnomAD
rs777859476	p.Val193Ile	missense variant	-	NC_000004.12:g.16191396C>T	ExAC,TOPMed,gnomAD
rs772074822	p.Ile194Val	missense variant	-	NC_000004.12:g.16191393T>C	ExAC,gnomAD
rs1441690125	p.Met202Val	missense variant	-	NC_000004.12:g.16191369T>C	TOPMed
rs1229075149	p.Asp207Asn	missense variant	-	NC_000004.12:g.16188349C>T	TOPMed,gnomAD
rs1282881473	p.Arg208Leu	missense variant	-	NC_000004.12:g.16188345C>A	gnomAD
rs750353463	p.Arg208Cys	missense variant	-	NC_000004.12:g.16188346G>A	ExAC,gnomAD
COSM4554527	p.Arg208His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.16188345C>T	NCI-TCGA Cosmic
rs1341404010	p.Ser211Leu	missense variant	-	NC_000004.12:g.16188336G>A	gnomAD
rs1433413741	p.Gly214Glu	missense variant	-	NC_000004.12:g.16188327C>T	gnomAD
rs1401876750	p.Ile217Thr	missense variant	-	NC_000004.12:g.16188318A>G	gnomAD
rs761241174	p.Ile217Val	missense variant	-	NC_000004.12:g.16188319T>C	ExAC,gnomAD
COSM1052804	p.Ala220Asp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.16188309G>T	NCI-TCGA Cosmic
rs763799449	p.Tyr222Cys	missense variant	-	NC_000004.12:g.16188303T>C	ExAC,TOPMed,gnomAD
rs777029268	p.Trp223Ter	stop gained	-	NC_000004.12:g.16188300C>T	ExAC,gnomAD
NCI-TCGA novel	p.Thr224Ile	missense variant	-	NC_000004.12:g.16188297G>A	NCI-TCGA
rs1186425611	p.Ala225Gly	missense variant	-	NC_000004.12:g.16188294G>C	gnomAD
rs761203835	p.Thr226Ala	missense variant	-	NC_000004.12:g.16188292T>C	ExAC,gnomAD
rs1448760482	p.Glu227Asp	missense variant	-	NC_000004.12:g.16188287C>A	gnomAD
rs774712114	p.Lys232Gln	missense variant	-	NC_000004.12:g.16188274T>G	ExAC,gnomAD
rs769040312	p.Arg233Ser	missense variant	-	NC_000004.12:g.16188269T>A	ExAC,TOPMed,gnomAD
rs1276265479	p.Ala234Thr	missense variant	-	NC_000004.12:g.16188268C>T	TOPMed,gnomAD
rs749073152	p.His235Pro	missense variant	-	NC_000004.12:g.16188264T>G	ExAC,TOPMed,gnomAD
rs200624831	p.Ile236Ser	missense variant	-	NC_000004.12:g.16188261A>C	1000Genomes,ExAC,TOPMed,gnomAD
rs200624831	p.Ile236Thr	missense variant	-	NC_000004.12:g.16188261A>G	1000Genomes,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ile236Leu	missense variant	-	NC_000004.12:g.16188262T>G	NCI-TCGA
rs895433054	p.Val238Met	missense variant	-	NC_000004.12:g.16188256C>T	TOPMed,gnomAD
rs1322278542	p.Phe242Cys	missense variant	-	NC_000004.12:g.16188243A>C	gnomAD
rs781046151	p.Met244Leu	missense variant	-	NC_000004.12:g.16188238T>A	ExAC,gnomAD
rs531208238	p.Val246Ile	missense variant	-	NC_000004.12:g.16188232C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs78659308	p.Val246Gly	missense variant	-	NC_000004.12:g.16188231A>C	ExAC,gnomAD
rs1241492513	p.Leu247Val	missense variant	-	NC_000004.12:g.16188229G>C	TOPMed
COSM3917360	p.Leu247Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.16188229G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Tyr248Ter	stop gained	-	NC_000004.12:g.16188224A>C	NCI-TCGA
COSM271552	p.His252Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.16186873G>A	NCI-TCGA Cosmic
rs1482999645	p.Ala253Val	missense variant	-	NC_000004.12:g.16186869G>A	gnomAD
NCI-TCGA novel	p.Ala253Thr	missense variant	-	NC_000004.12:g.16186870C>T	NCI-TCGA
rs1207054473	p.Ile254Asn	missense variant	-	NC_000004.12:g.16186866A>T	gnomAD
rs756498331	p.Ile254Val	missense variant	-	NC_000004.12:g.16186867T>C	ExAC,gnomAD
rs370968275	p.Leu255Phe	missense variant	-	NC_000004.12:g.16186864G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs768047657	p.Ile256Lys	missense variant	-	NC_000004.12:g.16186860A>T	ExAC,TOPMed,gnomAD
rs768047657	p.Ile256Thr	missense variant	-	NC_000004.12:g.16186860A>G	ExAC,TOPMed,gnomAD
rs768047657	p.Ile256Arg	missense variant	-	NC_000004.12:g.16186860A>C	ExAC,TOPMed,gnomAD
rs368839711	p.Met257Ile	missense variant	-	NC_000004.12:g.16186856C>T	ESP,ExAC,gnomAD
rs1325017708	p.Met257Arg	missense variant	-	NC_000004.12:g.16186857A>C	gnomAD
rs1325017708	p.Met257Thr	missense variant	-	NC_000004.12:g.16186857A>G	gnomAD
rs1339235821	p.Gln259Arg	missense variant	-	NC_000004.12:g.16186851T>C	TOPMed
rs752147500	p.Thr261Ala	missense variant	-	NC_000004.12:g.16186846T>C	ExAC,gnomAD
rs1299884884	p.Asn264Ser	missense variant	-	NC_000004.12:g.16186836T>C	gnomAD
rs535433678	p.Ala266Gly	missense variant	-	NC_000004.12:g.16186830G>C	1000Genomes,ExAC,gnomAD
rs893390254	p.His270Tyr	missense variant	-	NC_000004.12:g.16186819G>A	TOPMed
rs1319494954	p.His270Gln	missense variant	-	NC_000004.12:g.16186817G>T	TOPMed
rs775774627	p.Asn271Ser	missense variant	-	NC_000004.12:g.16186815T>C	ExAC,gnomAD
rs769946504	p.Lys272Arg	missense variant	-	NC_000004.12:g.16186812T>C	ExAC,TOPMed,gnomAD
rs759350471	p.Thr276Ala	missense variant	-	NC_000004.12:g.16186801T>C	ExAC,gnomAD
rs1226133587	p.Ile277Thr	missense variant	-	NC_000004.12:g.16186797A>G	gnomAD
COSM6166664	p.Met278Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.16186793C>T	NCI-TCGA Cosmic
rs770743888	p.Met279Thr	missense variant	-	NC_000004.12:g.16186791A>G	ExAC,gnomAD
rs200499081	p.Lys287Glu	missense variant	-	NC_000004.12:g.16186592T>C	TOPMed,gnomAD
rs985388924	p.Gly288Ala	missense variant	-	NC_000004.12:g.16186588C>G	TOPMed
rs1485881632	p.Lys293Arg	missense variant	-	NC_000004.12:g.16186573T>C	gnomAD
rs200147947	p.Asn298Ser	missense variant	-	NC_000004.12:g.16186558T>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Phe300Val	missense variant	-	NC_000004.12:g.16186553A>C	NCI-TCGA
rs1385086448	p.Asp306Val	missense variant	-	NC_000004.12:g.16179657T>A	gnomAD
rs756821981	p.Asp306Asn	missense variant	-	NC_000004.12:g.16186535C>T	TOPMed,gnomAD
rs756821981	p.Asp306His	missense variant	-	NC_000004.12:g.16186535C>G	TOPMed,gnomAD
rs1344982138	p.Ile307Phe	missense variant	-	NC_000004.12:g.16179655T>A	gnomAD
rs1369292980	p.Arg310Gln	missense variant	-	NC_000004.12:g.16179645C>T	gnomAD
rs1187375742	p.Phe311Tyr	missense variant	-	NC_000004.12:g.16179642A>T	TOPMed
rs1167681390	p.Thr312Ile	missense variant	-	NC_000004.12:g.16179639G>A	gnomAD
rs1462872182	p.Asn313Lys	missense variant	-	NC_000004.12:g.16179635A>T	gnomAD
rs1173530398	p.Leu316Arg	missense variant	-	NC_000004.12:g.16179627A>C	gnomAD
COSM1052802	p.Leu316Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.16179628G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ile319Met	missense variant	-	NC_000004.12:g.16179617T>C	NCI-TCGA
rs1269011618	p.Cys321Ser	missense variant	-	NC_000004.12:g.16179613A>T	gnomAD
rs1482019323	p.Gln327Arg	missense variant	-	NC_000004.12:g.16179594T>C	gnomAD
rs1379890300	p.Pro332Ser	missense variant	-	NC_000004.12:g.16179580G>A	TOPMed
rs767322893	p.Asp333Glu	missense variant	-	NC_000004.12:g.16176227A>T	ExAC,gnomAD
rs1261745089	p.His334Arg	missense variant	-	NC_000004.12:g.16176225T>C	TOPMed
rs1163575186	p.Phe339Cys	missense variant	-	NC_000004.12:g.16176210A>C	gnomAD
rs1327175053	p.Cys343Ser	missense variant	-	NC_000004.12:g.16176198C>G	gnomAD
rs1240423595	p.Met344Thr	missense variant	-	NC_000004.12:g.16176195A>G	gnomAD
rs1279433074	p.Met344Val	missense variant	-	NC_000004.12:g.16176196T>C	gnomAD
rs1338086129	p.Met344Ile	missense variant	-	NC_000004.12:g.16176194C>A	TOPMed,gnomAD
rs1310997111	p.Val345Ile	missense variant	-	NC_000004.12:g.16176193C>T	TOPMed,gnomAD
rs761619456	p.Ile346Thr	missense variant	-	NC_000004.12:g.16176189A>G	ExAC,gnomAD
rs991064906	p.Ala347Pro	missense variant	-	NC_000004.12:g.16176187C>G	TOPMed
COSM3825480	p.Glu349Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.16176181C>G	NCI-TCGA Cosmic
rs990621989	p.Ala351Thr	missense variant	-	NC_000004.12:g.16176175C>T	TOPMed
rs767995210	p.Val352Ala	missense variant	-	NC_000004.12:g.16176171A>G	ExAC,gnomAD
rs1455132724	p.Val352Met	missense variant	-	NC_000004.12:g.16176172C>T	TOPMed,gnomAD
rs1387227130	p.Asp353Asn	missense variant	-	NC_000004.12:g.16176169C>T	TOPMed
rs869312980	p.Asp353Val	missense variant	-	NC_000004.12:g.16176168T>A	-
rs869312980	p.Asp353Val	missense variant	Osteochondrodysplasia, complex lethal, Symoens-Barnes-Gistelinck type (OCLSBG)	NC_000004.12:g.16176168T>A	UniProt,dbSNP
VAR_076497	p.Asp353Val	missense variant	Osteochondrodysplasia, complex lethal, Symoens-Barnes-Gistelinck type (OCLSBG)	NC_000004.12:g.16176168T>A	UniProt
RCV000210534	p.Asp353Val	missense variant	Osteochondrodysplasia, complex lethal, symoens-barnes-gistelinck type (OCLSBG)	NC_000004.12:g.16176168T>A	ClinVar
rs775249703	p.Ile354Val	missense variant	-	NC_000004.12:g.16176166T>C	ExAC,gnomAD
rs937400048	p.His357Tyr	missense variant	-	NC_000004.12:g.16176157G>A	TOPMed
rs1182741102	p.Asn364Ser	missense variant	-	NC_000004.12:g.16176135T>C	TOPMed,gnomAD
rs1182741102	p.Asn364Thr	missense variant	-	NC_000004.12:g.16176135T>G	TOPMed,gnomAD
NCI-TCGA novel	p.Asp365Tyr	missense variant	-	NC_000004.12:g.16176133C>A	NCI-TCGA
rs1445089900	p.Thr367Ala	missense variant	-	NC_000004.12:g.16176127T>C	TOPMed,gnomAD
rs745533823	p.Asp369Glu	missense variant	-	NC_000004.12:g.16176119A>T	ExAC
rs1222430245	p.Val370Ile	missense variant	-	NC_000004.12:g.16174729C>T	gnomAD
rs766568331	p.Glu373Asp	missense variant	-	NC_000004.12:g.16174718T>G	ExAC,TOPMed,gnomAD
rs756280549	p.Arg375Lys	missense variant	-	NC_000004.12:g.16174713C>T	ExAC,gnomAD
rs756280549	p.Arg375Ile	missense variant	-	NC_000004.12:g.16174713C>A	ExAC,gnomAD
rs1226712701	p.Ala376Asp	missense variant	-	NC_000004.12:g.16174710G>T	gnomAD
rs767236884	p.Ser377Thr	missense variant	-	NC_000004.12:g.16174707C>G	ExAC,gnomAD
rs1016454514	p.Ala379Gly	missense variant	-	NC_000004.12:g.16174701G>C	TOPMed,gnomAD
rs1432211055	p.Ala379Ser	missense variant	-	NC_000004.12:g.16174702C>A	gnomAD
rs1302422081	p.Phe380Leu	missense variant	-	NC_000004.12:g.16174697A>T	gnomAD
rs761686384	p.Asp381Glu	missense variant	-	NC_000004.12:g.16174694G>C	ExAC,gnomAD
rs1367422449	p.Leu382Arg	missense variant	-	NC_000004.12:g.16174692A>C	gnomAD
rs1168727929	p.Arg386Gln	missense variant	-	NC_000004.12:g.16174680C>T	gnomAD
rs762345005	p.Gln387His	missense variant	-	NC_000004.12:g.16174676C>G	ExAC,gnomAD
rs1266903876	p.Asn389Ser	missense variant	-	NC_000004.12:g.16174671T>C	gnomAD
NCI-TCGA novel	p.Thr392Ile	missense variant	-	NC_000004.12:g.16174265G>A	NCI-TCGA
rs1404094078	p.Ser397Thr	missense variant	-	NC_000004.12:g.16174251A>T	gnomAD
rs1336396708	p.Val398Ile	missense variant	-	NC_000004.12:g.16174248C>T	gnomAD
rs770656839	p.Ala399Thr	missense variant	-	NC_000004.12:g.16174245C>T	ExAC,TOPMed,gnomAD
rs770656839	p.Ala399Ser	missense variant	-	NC_000004.12:g.16174245C>A	ExAC,TOPMed,gnomAD
rs374024583	p.Arg400Trp	missense variant	-	NC_000004.12:g.16174242G>A	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Arg401Met	missense variant	-	NC_000004.12:g.16174238C>A	NCI-TCGA
rs1157513595	p.Phe404Leu	missense variant	-	NC_000004.12:g.16174230A>G	gnomAD
rs1400588920	p.Leu407Phe	missense variant	-	NC_000004.12:g.16174221G>A	gnomAD
rs774729517	p.Leu409Pro	missense variant	-	NC_000004.12:g.16174214A>G	ExAC,gnomAD
rs1242133110	p.Val411Ile	missense variant	-	NC_000004.12:g.16174209C>T	gnomAD
rs751757066	p.Ile414Thr	missense variant	-	NC_000004.12:g.16170725A>G	ExAC,gnomAD
NCI-TCGA novel	p.Ile414Met	missense variant	-	NC_000004.12:g.16170724G>C	NCI-TCGA
rs1185362521	p.Arg415Lys	missense variant	-	NC_000004.12:g.16170722C>T	gnomAD
rs777554972	p.Val417Leu	missense variant	-	NC_000004.12:g.16170717C>A	ExAC,gnomAD
rs758279791	p.Thr418Ser	missense variant	-	NC_000004.12:g.16170714T>A	ExAC,TOPMed,gnomAD
rs1358419544	p.Ser419Ile	missense variant	-	NC_000004.12:g.16170710C>A	gnomAD
rs752666747	p.Ile421Val	missense variant	-	NC_000004.12:g.16170705T>C	ExAC,gnomAD
rs370585771	p.Ile421Thr	missense variant	-	NC_000004.12:g.16170704A>G	ESP,TOPMed,gnomAD
rs1323664698	p.Ile421Met	missense variant	-	NC_000004.12:g.16170703A>C	gnomAD
rs1293790897	p.Lys422Glu	missense variant	-	NC_000004.12:g.16170702T>C	gnomAD
rs1362812845	p.Gln424Arg	missense variant	-	NC_000004.12:g.16170695T>C	gnomAD
rs1300553738	p.Tyr429Cys	missense variant	-	NC_000004.12:g.16170680T>C	gnomAD
rs1365532788	p.Ala430Gly	missense variant	-	NC_000004.12:g.16170677G>C	gnomAD
rs759085460	p.Ile433Val	missense variant	-	NC_000004.12:g.16170669T>C	ExAC,gnomAD
COSM5812631	p.Tyr436Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.16170659T>C	NCI-TCGA Cosmic
rs1370979711	p.Phe437Ser	missense variant	-	NC_000004.12:g.16170656A>G	gnomAD
rs190919307	p.Phe437Leu	missense variant	-	NC_000004.12:g.16170655A>C	1000Genomes
rs1301240125	p.Leu439Ser	missense variant	-	NC_000004.12:g.16166791A>G	gnomAD
rs775884805	p.Ile440Thr	missense variant	-	NC_000004.12:g.16166788A>G	ExAC,gnomAD
rs935776529	p.Ser441Cys	missense variant	-	NC_000004.12:g.16166785G>C	TOPMed,gnomAD
COSM5905597	p.Ser441Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.16166785G>A	NCI-TCGA Cosmic
rs774074379	p.Leu445Phe	missense variant	-	NC_000004.12:g.16166774G>A	ExAC,TOPMed
rs774074379	p.Leu445Ile	missense variant	-	NC_000004.12:g.16166774G>T	ExAC,TOPMed
COSM1052801	p.Leu445Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.16166773A>C	NCI-TCGA Cosmic
rs1275841479	p.Ser447Asn	missense variant	-	NC_000004.12:g.16166767C>T	TOPMed
NCI-TCGA novel	p.Ser447Cys	missense variant	-	NC_000004.12:g.16166768T>A	NCI-TCGA
rs1334539487	p.Ile448Val	missense variant	-	NC_000004.12:g.16166765T>C	gnomAD
rs1010156933	p.Val449Met	missense variant	-	NC_000004.12:g.16166762C>T	gnomAD
COSM1052800	p.Ser454Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.16166746G>A	NCI-TCGA Cosmic
rs1480843874	p.Gln456Arg	missense variant	-	NC_000004.12:g.16166740T>C	TOPMed
rs773452270	p.Tyr457Cys	missense variant	-	NC_000004.12:g.16166737T>C	ExAC,gnomAD
rs772471035	p.Val458Met	missense variant	-	NC_000004.12:g.16166735C>T	ExAC,gnomAD
rs1182175969	p.Ala461Thr	missense variant	-	NC_000004.12:g.16166726C>T	gnomAD
NCI-TCGA novel	p.Lys462Asn	missense variant	-	NC_000004.12:g.16166721T>A	NCI-TCGA
rs35606284	p.Glu465Lys	missense variant	-	NC_000004.12:g.16166714C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs35606284	p.Glu465Lys	missense variant	-	NC_000004.12:g.16166714C>T	UniProt,dbSNP
VAR_042568	p.Glu465Lys	missense variant	-	NC_000004.12:g.16166714C>T	UniProt
rs1433919519	p.Leu467Arg	missense variant	-	NC_000004.12:g.16166707A>C	TOPMed,gnomAD
rs540552859	p.Leu467Val	missense variant	-	NC_000004.12:g.16166708G>C	1000Genomes
rs749192598	p.Ser468Leu	missense variant	-	NC_000004.12:g.16166704G>A	ExAC,gnomAD
rs749192598	p.Ser468Trp	missense variant	-	NC_000004.12:g.16166704G>C	ExAC,gnomAD
rs1202265438	p.Pro470Arg	missense variant	-	NC_000004.12:g.16166698G>C	TOPMed,gnomAD
rs1263787327	p.Pro470Ala	missense variant	-	NC_000004.12:g.16166699G>C	gnomAD
NCI-TCGA novel	p.Pro470His	missense variant	-	NC_000004.12:g.16166698G>T	NCI-TCGA
rs1349085629	p.Pro471Ala	missense variant	-	NC_000004.12:g.16166696G>C	TOPMed,gnomAD
rs1349085629	p.Pro471Ser	missense variant	-	NC_000004.12:g.16166696G>A	TOPMed,gnomAD
rs1302799056	p.Pro471Arg	missense variant	-	NC_000004.12:g.16166695G>C	TOPMed
rs376072922	p.Ala472Thr	missense variant	-	NC_000004.12:g.16166693C>T	ESP,ExAC,TOPMed,gnomAD
rs1312425895	p.Thr473Asn	missense variant	-	NC_000004.12:g.16166689G>T	gnomAD
rs1297851595	p.Thr475Pro	missense variant	-	NC_000004.12:g.16166684T>G	TOPMed
rs1335552338	p.Pro479Leu	missense variant	-	NC_000004.12:g.16166671G>A	gnomAD
rs765524755	p.Ser480Cys	missense variant	-	NC_000004.12:g.16166668G>C	ExAC,gnomAD
rs765524755	p.Ser480Phe	missense variant	-	NC_000004.12:g.16166668G>A	ExAC,gnomAD
rs759872460	p.Asn485Asp	missense variant	-	NC_000004.12:g.16166654T>C	ExAC
NCI-TCGA novel	p.Asn485Ser	missense variant	-	NC_000004.12:g.16166653T>C	NCI-TCGA
rs777190099	p.Pro489Thr	missense variant	-	NC_000004.12:g.16166642G>T	ExAC,gnomAD
rs766833715	p.Pro489His	missense variant	-	NC_000004.12:g.16166641G>T	ExAC,gnomAD
rs766833715	p.Pro489Leu	missense variant	-	NC_000004.12:g.16166641G>A	ExAC,gnomAD
rs369049796	p.Ser490Ala	missense variant	-	NC_000004.12:g.16166639A>C	ESP,ExAC,TOPMed,gnomAD
rs1238279010	p.Gln491Arg	missense variant	-	NC_000004.12:g.16166635T>C	gnomAD
rs138378020	p.Gly492Ser	missense variant	-	NC_000004.12:g.16166633C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs138378020	p.Gly492Arg	missense variant	-	NC_000004.12:g.16166633C>G	1000Genomes,ExAC,TOPMed,gnomAD
rs1270219564	p.Leu493Val	missense variant	-	NC_000004.12:g.16163535G>C	TOPMed,gnomAD
rs1270219564	p.Leu493Phe	missense variant	-	NC_000004.12:g.16163535G>A	TOPMed,gnomAD
rs929230368	p.Thr495Arg	missense variant	-	NC_000004.12:g.16163528G>C	TOPMed,gnomAD
rs1350225487	p.Thr495Ala	missense variant	-	NC_000004.12:g.16163529T>C	TOPMed
rs929230368	p.Thr495Ile	missense variant	-	NC_000004.12:g.16163528G>A	TOPMed,gnomAD
rs1282632507	p.Glu496Gln	missense variant	-	NC_000004.12:g.16163526C>G	gnomAD
rs1438602541	p.Glu497Lys	missense variant	-	NC_000004.12:g.16163523C>T	TOPMed
rs754203436	p.Asn498Ser	missense variant	-	NC_000004.12:g.16163519T>C	ExAC,gnomAD
rs1326644966	p.Leu499Met	missense variant	-	NC_000004.12:g.16163517G>T	gnomAD
rs200723168	p.Ser500Phe	missense variant	-	NC_000004.12:g.16163513G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1408379866	p.Ser500Thr	missense variant	-	NC_000004.12:g.16163514A>T	gnomAD
rs767648516	p.Ser502Pro	missense variant	-	NC_000004.12:g.16163508A>G	ExAC,gnomAD
rs1427798682	p.Ser502Phe	missense variant	-	NC_000004.12:g.16163507G>A	gnomAD
rs762043208	p.Ile503Val	missense variant	-	NC_000004.12:g.16163505T>C	ExAC,TOPMed,gnomAD
rs762043208	p.Ile503Leu	missense variant	-	NC_000004.12:g.16163505T>G	ExAC,TOPMed,gnomAD
COSM4911788	p.Ile503Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.16163504A>T	NCI-TCGA Cosmic
rs774714118	p.Thr504Ser	missense variant	-	NC_000004.12:g.16163502T>A	ExAC,TOPMed,gnomAD
rs768802773	p.Thr504Ser	missense variant	-	NC_000004.12:g.16163501G>C	ExAC,gnomAD
COSM4123215	p.Gln506Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000004.12:g.16163496G>A	NCI-TCGA Cosmic
rs1274252929	p.His509Arg	missense variant	-	NC_000004.12:g.16163486T>C	TOPMed
rs1258305087	p.Gln510Arg	missense variant	-	NC_000004.12:g.16163483T>C	gnomAD
rs376420202	p.Ile515Val	missense variant	-	NC_000004.12:g.16163469T>C	ExAC,gnomAD
COSM4123214	p.Ile515Met	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.16163467T>C	NCI-TCGA Cosmic
rs1320865474	p.Pro516Ser	missense variant	-	NC_000004.12:g.16163466G>A	gnomAD
rs781162028	p.Val519Met	missense variant	-	NC_000004.12:g.16163457C>T	ExAC,TOPMed,gnomAD
rs1219700041	p.Val519Gly	missense variant	-	NC_000004.12:g.16163456A>C	gnomAD
rs770420838	p.Thr520Lys	missense variant	-	NC_000004.12:g.16163453G>T	ExAC,TOPMed,gnomAD
rs16893137	p.Asn522Thr	missense variant	-	NC_000004.12:g.16163447T>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs16893137	p.Asn522Ser	missense variant	-	NC_000004.12:g.16163447T>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1441215553	p.Asp524His	missense variant	-	NC_000004.12:g.16163442C>G	gnomAD
rs1441215553	p.Asp524Tyr	missense variant	-	NC_000004.12:g.16163442C>A	gnomAD
COSM3825479	p.Gln525Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.16163438T>C	NCI-TCGA Cosmic
NCI-TCGA novel	p.Phe526Cys	missense variant	-	NC_000004.12:g.16163435A>C	NCI-TCGA
rs777380785	p.Leu527Phe	missense variant	-	NC_000004.12:g.16163431C>G	ExAC,gnomAD
NCI-TCGA novel	p.Leu527Ter	frameshift	-	NC_000004.12:g.16163432A>-	NCI-TCGA
NCI-TCGA novel	p.Thr529Ile	missense variant	-	NC_000004.12:g.16163426G>A	NCI-TCGA
rs1332366063	p.Pro530Ala	missense variant	-	NC_000004.12:g.16163424G>C	gnomAD
rs759054678	p.Asp531Glu	missense variant	-	NC_000004.12:g.16163419A>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Asp531Asn	missense variant	-	NC_000004.12:g.16163421C>T	NCI-TCGA
NCI-TCGA novel	p.Gly532Val	missense variant	-	NC_000004.12:g.16163417C>A	NCI-TCGA
NCI-TCGA novel	p.Gly532Ser	missense variant	-	NC_000004.12:g.16163418C>T	NCI-TCGA
rs34007466	p.Asp533Glu	missense variant	-	NC_000004.12:g.16163413G>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs780216458	p.Glu534Lys	missense variant	-	NC_000004.12:g.16163412C>T	ExAC,TOPMed,gnomAD
rs1427878367	p.Asp536Gly	missense variant	-	NC_000004.12:g.16163405T>C	gnomAD
rs541506067	p.Asp536Asn	missense variant	-	NC_000004.12:g.16163406C>T	1000Genomes,ExAC,gnomAD
rs750954747	p.Ile537Leu	missense variant	-	NC_000004.12:g.16163403T>A	ExAC,TOPMed,gnomAD
rs374613998	p.Thr538Lys	missense variant	-	NC_000004.12:g.16163399G>T	ESP,ExAC,TOPMed,gnomAD
rs374613998	p.Thr538Met	missense variant	-	NC_000004.12:g.16163399G>A	ESP,ExAC,TOPMed,gnomAD
rs572498159	p.Asn541Ser	missense variant	-	NC_000004.12:g.16163390T>C	1000Genomes,ExAC,gnomAD
COSM1052799	p.Ser542Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.16163387G>T	NCI-TCGA Cosmic
rs1162365688	p.Ser542Cys	missense variant	-	NC_000004.12:g.16163387G>C	TOPMed
NCI-TCGA novel	p.Lys545AsnPheSerTerUnkUnk	frameshift	-	NC_000004.12:g.16163377T>-	NCI-TCGA
rs1400493375	p.His546Gln	missense variant	-	NC_000004.12:g.16163374G>C	TOPMed
rs1299546491	p.Arg547Thr	missense variant	-	NC_000004.12:g.16163372C>G	TOPMed
rs764260680	p.Arg547Ser	missense variant	-	NC_000004.12:g.16163371T>A	ExAC,gnomAD
rs1373825780	p.Ser548Ala	missense variant	-	NC_000004.12:g.16163370A>C	gnomAD
rs191294901	p.Ser549Pro	missense variant	-	NC_000004.12:g.16163367A>G	1000Genomes,TOPMed
NCI-TCGA novel	p.Lys550Asn	missense variant	-	NC_000004.12:g.16163362C>A	NCI-TCGA
COSM3775671	p.Glu555Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000004.12:g.16163349C>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Arg558Ser	missense variant	-	NC_000004.12:g.16163338C>A	NCI-TCGA
rs1313817124	p.Asp567Asn	missense variant	-	NC_000004.12:g.16163313C>T	gnomAD
rs775790806	p.Asp567Gly	missense variant	-	NC_000004.12:g.16163312T>C	ExAC,gnomAD

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0003962	Ascites	phenotype	HPO
C0007194	Hypertrophic Cardiomyopathy	disease	HPO
C0009917	Contracture	group	HPO
C0009918	Contracture of joint	phenotype	HPO
C0015934	Fetal Growth Retardation	phenotype	HPO
C0018800	Cardiomegaly	phenotype	HPO
C0018818	Ventricular Septal Defects	group	HPO
C0020224	Polyhydramnios	phenotype	HPO
C0020295	Hydronephrosis	disease	HPO
C0020305	Hydrops Fetalis	disease	HPO
C0020534	Orbital separation excessive	phenotype	HPO
C0021296	Infant, Small for Gestational Age	phenotype	HPO
C0024032	Low Birth Weights	phenotype	HPO
C0025990	Micrognathism	disease	HPO
C0026707	Mucopolysaccharidosis IV	disease	BEFREE
C0029422	Osteochondrodysplasias	group	BEFREE
C0029434	Osteogenesis Imperfecta	disease	GENOMICS_ENGLAND
C0029453	Osteopenia	disease	HPO
C0032227	Pleural effusion disorder	group	HPO
C0034628	Radius Fractures	phenotype	HPO
C0221217	Neck webbing	disease	HPO
C0221356	Brachycephaly	disease	HPO
C0235991	Small for gestational age (disorder)	phenotype	HPO
C0239234	Low set ears	phenotype	HPO
C0239399	Short extremities	phenotype	HPO
C0265783	Congenital hypoplasia of lung	disease	HPO
C0266435	Congenital hypoplasia of penis	disease	HPO
C0266470	Cerebellar Hypoplasia	disease	HPO
C0272567	Fracture of multiple ribs	phenotype	HPO
C0333068	Flexion contracture	phenotype	HPO
C0345375	Congenital hypoplasia of femur	disease	HPO
C0392006	Unilateral cleft lip	disease	HPO
C0423113	Telecanthus	phenotype	HPO
C0424688	Small head	phenotype	HPO
C0426414	Small nose	phenotype	HPO
C0426817	Short ribs	phenotype	HPO
C0426824	Beading of ribs	disease	HPO
C0431478	Posteriorly rotated ear	disease	HPO
C0432073	Defect of skull ossification	group	HPO
C0521525	Short neck	phenotype	HPO
C0747078	Generalized osteopenia	disease	HPO
C0848558	Hypospadias	group	HPO
C1384670	Single umbilical artery	disease	HPO
C1386048	Intrauterine retardation	phenotype	HPO
C1691215	Penile hypospadias	disease	HPO
C1837260	Prominent forehead	phenotype	HPO
C1837482	Thoracic hypoplasia	disease	HPO
C1839764	Broad flat nasal bridge	phenotype	HPO
C1840077	Anteverted nostril	phenotype	HPO
C1844704	Platyspondyly	phenotype	HPO
C1849367	Nasal bridge wide	phenotype	HPO
C1850135	Flared metaphysis	phenotype	HPO
C1850530	Flexion contractures of joints	phenotype	HPO
C1853171	Multiple prenatal fractures	phenotype	HPO
C1853241	Flat face	phenotype	HPO
C1854114	Short nose	phenotype	HPO
C1857130	Hypoplastic mandible condyle	phenotype	HPO
C1867446	Bulging forehead	phenotype	HPO
C2981150	Uranostaphyloschisis	disease	HPO
C3278923	Dilated ventricles (finding)	phenotype	HPO
C3554617	Adducted thumb	phenotype	HPO
C3808403	Large fleshy ears	phenotype	HPO
C4024589	Aplasia/Hypoplasia of the mandible	phenotype	HPO
C4072823	Broad cranium shape	phenotype	HPO
C4072824	Wide skull shape	phenotype	HPO
C4225162	OSTEOCHONDRODYSPLASIA, COMPLEX LETHAL, SYMOENS-BARNES-GISTELINCK TYPE	disease	CLINVAR;CTD_human;ORPHANET;UNIPROT
C4277690	Ciliopathies	group	BEFREE;GENOMICS_ENGLAND
C4280533	Decreased calcification of skull	phenotype	HPO
C4476523	Decreased projection of lower jaw	phenotype	HPO
C4476524	Decreased projection of mandible	phenotype	HPO
C4476525	Retrusion of lower jaw	phenotype	HPO

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0016520	growth hormone-releasing hormone receptor activity	TAS

GO:Biological Process

GO ID	GO Term	Evidence
GO:0001503	ossification	IEA
GO:0007186	G protein-coupled receptor signaling pathway	IEA
GO:0014032	neural crest cell development	ISS
GO:0016032	viral process	IEA
GO:0030030	cell projection organization	IEA
GO:0035437	maintenance of protein localization in endoplasmic reticulum	IBA
GO:0045724	positive regulation of cilium assembly	IBA
GO:0045724	positive regulation of cilium assembly	IDA
GO:0048706	embryonic skeletal system development	IEA
GO:0051216	cartilage development	IEA
GO:0061036	positive regulation of cartilage development	ISS
GO:1903012	positive regulation of bone development	ISS

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0005783	endoplasmic reticulum	IBA
GO:0005813	centrosome	IDA
GO:0016021	integral component of membrane	TAS
GO:0030176	integral component of endoplasmic reticulum membrane	IBA
GO:0036064	ciliary basal body	IBA
GO:0036064	ciliary basal body	IDA

Reactome Pathway

Reactome ID	Reactome Term	Evidence

Drugs and compounds information

ID	Drug Name	Action	PubMed
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of TAPT1 mRNA	27188386
C496492	abrine	abrine results in increased expression of TAPT1 mRNA	31054353
D000082	Acetaminophen	Acetaminophen results in decreased expression of TAPT1 mRNA	29067470
D000082	Acetaminophen	Acetaminophen results in increased expression of TAPT1 mRNA	21420995
D016604	Aflatoxin B1	Aflatoxin B1 results in decreased methylation of TAPT1 gene	27153756
C006780	bisphenol A	bisphenol A affects the expression of TAPT1 mRNA	21786754
C006780	bisphenol A	bisphenol A affects the expression of TAPT1 mRNA	25181051
C006780	bisphenol A	bisphenol A results in increased expression of TAPT1 mRNA	30816183
D002794	Choline	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased methylation of TAPT1 gene	20938992
D002945	Cisplatin	[Cisplatin co-treated with jinfukang] results in decreased expression of TAPT1 mRNA	27392435
D002945	Cisplatin	Cisplatin results in decreased expression of TAPT1 mRNA	27392435
C000944	dicrotophos	dicrotophos results in decreased expression of TAPT1 mRNA	28302478
D004026	Dieldrin	Dieldrin results in increased expression of TAPT1 mRNA	28385952
C516138	dorsomorphin	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of TAPT1 mRNA	27188386
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in decreased expression of TAPT1 mRNA	23129252
D005020	Ethyl Methanesulfonate	Ethyl Methanesulfonate results in increased expression of TAPT1 mRNA	23649840
D017313	Fenretinide	Fenretinide results in increased expression of TAPT1 mRNA	28973697
D005492	Folic Acid	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased methylation of TAPT1 gene	20938992
D005947	Glucose	[INS protein co-treated with Glucose] results in increased expression of TAPT1 mRNA	22634610
C492448	ICG 001	ICG 001 results in decreased expression of TAPT1 mRNA	26191083
D015759	Ionomycin	[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in decreased expression of TAPT1 mRNA	25613284
C544151	jinfukang	[Cisplatin co-treated with jinfukang] results in decreased expression of TAPT1 mRNA	27392435
C544151	jinfukang	jinfukang results in decreased expression of TAPT1 mRNA	27392435
D008715	Methionine	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased methylation of TAPT1 gene	20938992
D008741	Methyl Methanesulfonate	Methyl Methanesulfonate results in increased expression of TAPT1 mRNA	23649840
D037742	Nanotubes, Carbon	Nanotubes, Carbon results in increased expression of TAPT1 mRNA	25620056
D000077150	Oxaliplatin	[Oxaliplatin co-treated with Topotecan] results in decreased expression of TAPT1 mRNA	25729387
C016030	pantogab	pantogab results in increased expression of TAPT1 mRNA	17379144
C101814	perfluoro-n-undecanoic acid	perfluoro-n-undecanoic acid results in decreased expression of TAPT1 mRNA	23602845
D010795	Phthalic Acids	Phthalic Acids results in increased expression of TAPT1 mRNA	21061450
C006253	pirinixic acid	[pirinixic acid binds to and results in increased activity of PPARA protein] which results in increased expression of TAPT1 mRNA	19710929
C006253	pirinixic acid	pirinixic acid results in increased expression of TAPT1 mRNA	23811191
C017947	sodium arsenite	sodium arsenite results in decreased expression of TAPT1 protein	29044176
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin affects the expression of TAPT1 mRNA	21570461
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin results in increased expression of TAPT1 mRNA	25975270
D013749	Tetrachlorodibenzodioxin	[TIPARP gene mutant form results in increased susceptibility to Tetrachlorodibenzodioxin] which results in increased expression of TAPT1 mRNA	25975270
D013755	Tetradecanoylphorbol Acetate	[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in decreased expression of TAPT1 mRNA	25613284
D019772	Topotecan	[Oxaliplatin co-treated with Topotecan] results in decreased expression of TAPT1 mRNA	25729387
C013320	tris(2-butoxyethyl) phosphate	tris(2-butoxyethyl) phosphate affects the expression of TAPT1 mRNA	29024780
D014635	Valproic Acid	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of TAPT1 mRNA	27188386
D014635	Valproic Acid	Valproic Acid results in decreased expression of TAPT1 mRNA	26272509; 28001369;
D014635	Valproic Acid	Valproic Acid results in decreased methylation of TAPT1 gene	29154799

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0007	Acetylation
KW-0025	Alternative splicing
KW-0966	Cell projection
KW-0891	Chondrogenesis
KW-1186	Ciliopathy
KW-0969	Cilium
KW-0970	Cilium biogenesis/degradation
KW-0963	Cytoplasm
KW-0206	Cytoskeleton
KW-0217	Developmental protein
KW-0221	Differentiation
KW-0225	Disease mutation
KW-0945	Host-virus interaction
KW-0472	Membrane
KW-0892	Osteogenesis
KW-0597	Phosphoprotein
KW-0621	Polymorphism
KW-0675	Receptor
KW-1185	Reference proteome
KW-0812	Transmembrane
KW-1133	Transmembrane helix

Interpro

InterPro ID	InterPro Term
IPR008010	Tatp1

PROSITE

PROSITE ID	PROSITE Term

Pfam

Pfam ID	Pfam Term
PF05346	DUF747

Gene: TAPT1

Basic information

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

There is no related protein structure for this gene.

Protein disorder information

Orthologous information

Other genetic variants/mutations

Disease or phenotype associated information

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO:Biological Process

GO:Cellular Component

Reactome Pathway

Drugs and compounds information

Functional annotations

Keywords

Interpro

PROSITE

Pfam

Protein-protein interaction

Protein-miRNA interaction