CleftGeneDB-Search

Gene: SOSTDC1

Basic information

Tag	Content
Uniprot ID	Q6X4U4; A8MUA6; Q96HJ7; Q9Y3U3;
Entrez ID	25928
Genbank protein ID	AAL57219.1; AAQ83296.1; BAG52710.1; CAB43243.2; AAH08484.1; AAQ96855.1; BAC20331.1;
Genbank nucleotide ID	NM_015464.2; XM_017011943.1;
Ensembl protein ID	ENSP00000304930; ENSP00000379889;
Ensembl nucleotide ID	ENSG00000171243
Gene name	Sclerostin domain-containing protein 1
Gene symbol	SOSTDC1
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type
Developmental stage
Data sources	Homology search
Reference
Functional description	May be involved in the onset of endometrial receptivity for implantation/sensitization for the decidual cell reaction Enhances Wnt signaling and inhibits TGF-beta signaling (By similarity). Directly antagonizes activity of BMP2, BMP4, BMP6 and BMP7 in a dose-dependent manner.
Sequence	MLPPAIHFYL LPLACILMKS CLAFKNDATE ILYSHVVKPV PAHPSSNSTL NQARNGGRHF 60 SNTGLDRNTR VQVGCRELRS TKYISDGQCT SISPLKELVC AGECLPLPVL PNWIGGGYGT 120 KYWSRRSSQE WRCVNDKTRT QRIQLQCQDG STRTYKITVV TACKCKRYTR QHNESSHNFE 180 SMSPAKPVQH HRERKRASKS SKHSMS 206

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

There is no related protein structure for this gene.

Protein disorder information

Protein disorder visualization from D2P2 is currently unavailable.

Orthologous information

Relation	Gene symbol	Entrez ID	UniProt ID	Cleft type	Species	Evidence	Details
1:1 ortholog	SOSTDC1	523184	Q2HJ20		Bos taurus	Prediction	More>>
1:1 ortholog	SOSTDC1	102178138	A0A452EBH8		Capra hircus	Prediction	More>>
1:1 ortholog	SOSTDC1	100052877	F6T7A1		Equus caballus	Prediction	More>>
1:1 ortholog	SOSTDC1	25928	Q6X4U4		Homo sapiens	Prediction	More>>
1:1 ortholog	Sostdc1	66042	Q9CQN4	CPO	Mus musculus	Publication	More>>
1:1 ortholog	SOSTDC1	100736999	F1SEJ1		Sus scrofa	Prediction	More>>
1:1 ortholog	SOSTDC1	100354321	G1T3J2		Oryctolagus cuniculus	Prediction	More>>
1:1 ortholog	Sostdc1	266803	Q642G2		Rattus norvegicus	Prediction	More>>
1:1 ortholog	sostdc1a	550261	A7MCD1		Danio rerio	Prediction	More>>

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
rs1042249101	p.Leu2His	missense variant	-	NC_000007.14:g.16465664A>T	TOPMed,gnomAD
rs1193130548	p.Pro3Arg	missense variant	-	NC_000007.14:g.16465661G>C	gnomAD
rs1371819953	p.Pro3Thr	missense variant	-	NC_000007.14:g.16465662G>T	gnomAD
NCI-TCGA novel	p.Pro3GluMet	insertion	-	NC_000007.14:g.16465659_16465660insCATTTC	NCI-TCGA
rs146877090	p.Ala5Val	missense variant	-	NC_000007.14:g.16465655G>A	ESP,ExAC,TOPMed,gnomAD
rs749975640	p.Ala5Thr	missense variant	-	NC_000007.14:g.16465656C>T	ExAC,gnomAD
rs757515286	p.His7Arg	missense variant	-	NC_000007.14:g.16465649T>C	ExAC,gnomAD
rs201141429	p.Tyr9Cys	missense variant	-	NC_000007.14:g.16465643T>C	ESP,ExAC,TOPMed,gnomAD
COSM3636904	p.Leu11Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000007.14:g.16465638G>A	NCI-TCGA Cosmic
rs1233884366	p.Pro12Leu	missense variant	-	NC_000007.14:g.16465634G>A	gnomAD
COSM1329916	p.Pro12Ala	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000007.14:g.16465635G>C	NCI-TCGA Cosmic
rs1439977997	p.Ile16Thr	missense variant	-	NC_000007.14:g.16465622A>G	gnomAD
rs1300963630	p.Ile16Val	missense variant	-	NC_000007.14:g.16465623T>C	gnomAD
rs1275991261	p.Leu17Pro	missense variant	-	NC_000007.14:g.16465619A>G	TOPMed
rs1370482439	p.Leu17Val	missense variant	-	NC_000007.14:g.16465620G>C	gnomAD
rs764764953	p.Lys19Thr	missense variant	-	NC_000007.14:g.16465613T>G	ExAC,gnomAD
NCI-TCGA novel	p.Ser20Asn	missense variant	-	NC_000007.14:g.16465610C>T	NCI-TCGA
rs1354977912	p.Cys21Ser	missense variant	-	NC_000007.14:g.16465607C>G	gnomAD
NCI-TCGA novel	p.Lys25Ter	stop gained	-	NC_000007.14:g.16465596T>A	NCI-TCGA
rs1167778470	p.Asp27Val	missense variant	-	NC_000007.14:g.16465589T>A	gnomAD
rs1251479346	p.Asp27Asn	missense variant	-	NC_000007.14:g.16465590C>T	TOPMed
rs752836380	p.Ala28Pro	missense variant	-	NC_000007.14:g.16465587C>G	ExAC,gnomAD
rs765339535	p.Thr29Ser	missense variant	-	NC_000007.14:g.16465584T>A	ExAC,gnomAD
rs765339535	p.Thr29Ala	missense variant	-	NC_000007.14:g.16465584T>C	ExAC,gnomAD
COSM3879934	p.Leu32Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000007.14:g.16465575G>T	NCI-TCGA Cosmic
rs1056056308	p.Ser34Pro	missense variant	-	NC_000007.14:g.16465569A>G	TOPMed,gnomAD
rs776665358	p.His35Asn	missense variant	-	NC_000007.14:g.16465566G>T	ExAC,TOPMed,gnomAD
rs776665358	p.His35Asp	missense variant	-	NC_000007.14:g.16465566G>C	ExAC,TOPMed,gnomAD
rs200976995	p.His35Arg	missense variant	-	NC_000007.14:g.16465565T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs776665358	p.His35Tyr	missense variant	-	NC_000007.14:g.16465566G>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.His35Gln	missense variant	-	NC_000007.14:g.16465564A>C	NCI-TCGA
NCI-TCGA novel	p.Lys38ThrPheSerTerUnkUnk	frameshift	-	NC_000007.14:g.16465545_16465558CTGGAACAGGTTTA>-	NCI-TCGA
rs143414289	p.Pro41Ser	missense variant	-	NC_000007.14:g.16465548G>A	ESP,ExAC,TOPMed,gnomAD
rs143414289	p.Pro41Ala	missense variant	-	NC_000007.14:g.16465548G>C	ESP,ExAC,TOPMed,gnomAD
rs149220410	p.His43Gln	missense variant	-	NC_000007.14:g.16465540G>T	ESP,ExAC,TOPMed,gnomAD
rs749168944	p.Pro44Arg	missense variant	-	NC_000007.14:g.16465538G>C	ExAC,gnomAD
rs972881922	p.Pro44Ala	missense variant	-	NC_000007.14:g.16465539G>C	TOPMed
rs1354173806	p.Ser46Arg	missense variant	-	NC_000007.14:g.16465531G>C	gnomAD
rs779546065	p.Ser48Ile	missense variant	-	NC_000007.14:g.16465526C>A	ExAC,gnomAD
rs372761532	p.Thr49Met	missense variant	-	NC_000007.14:g.16465523G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs745557822	p.Thr49Ser	missense variant	-	NC_000007.14:g.16465524T>A	ExAC,gnomAD
NCI-TCGA novel	p.Thr49GlnPheSerTerUnkUnk	frameshift	-	NC_000007.14:g.16465524_16465525insGCGATTTGATAGGTATGTTCTCTAATTG	NCI-TCGA
rs1311648591	p.Leu50Met	missense variant	-	NC_000007.14:g.16465521A>T	gnomAD
rs140752909	p.Leu50Phe	missense variant	-	NC_000007.14:g.16465519C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs778224847	p.Asn51Ser	missense variant	-	NC_000007.14:g.16465517T>C	ExAC,TOPMed,gnomAD
rs1468270537	p.Asn55Ile	missense variant	-	NC_000007.14:g.16465505T>A	TOPMed,gnomAD
COSM3879933	p.Asn55His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000007.14:g.16465506T>G	NCI-TCGA Cosmic
rs753212683	p.Arg58Ser	missense variant	-	NC_000007.14:g.16465495C>G	ExAC,TOPMed,gnomAD
rs199505711	p.His59Gln	missense variant	-	NC_000007.14:g.16465492A>T	ExAC,TOPMed,gnomAD
rs753919706	p.Phe60Cys	missense variant	-	NC_000007.14:g.16465490A>C	ExAC,gnomAD
rs1210112237	p.Leu65Met	missense variant	-	NC_000007.14:g.16465476G>T	NCI-TCGA
rs1210112237	p.Leu65Met	missense variant	-	NC_000007.14:g.16465476G>T	gnomAD
rs1488458082	p.Asp66His	missense variant	-	NC_000007.14:g.16465473C>G	gnomAD
rs760941550	p.Asp66Val	missense variant	-	NC_000007.14:g.16465472T>A	ExAC,gnomAD
NCI-TCGA novel	p.Asp66Asn	missense variant	-	NC_000007.14:g.16465473C>T	NCI-TCGA
rs762912136	p.Arg67Gln	missense variant	-	NC_000007.14:g.16465469C>T	ExAC,gnomAD
rs778378406	p.Arg67Gly	missense variant	-	NC_000007.14:g.16465470G>C	ExAC,TOPMed,gnomAD
rs778378406	p.Arg67Trp	missense variant	-	NC_000007.14:g.16465470G>A	ExAC,TOPMed,gnomAD
rs778378406	p.Arg67Trp	missense variant	-	NC_000007.14:g.16465470G>A	NCI-TCGA,NCI-TCGA Cosmic
rs1279233325	p.Asn68Lys	missense variant	-	NC_000007.14:g.16465465G>C	gnomAD
rs771816268	p.Thr69Ile	missense variant	-	NC_000007.14:g.16462963G>A	ExAC,TOPMed,gnomAD
rs755457276	p.Arg70Pro	missense variant	-	NC_000007.14:g.16462960C>G	ExAC,TOPMed,gnomAD
rs755457276	p.Arg70Leu	missense variant	-	NC_000007.14:g.16462960C>A	ExAC,TOPMed,gnomAD
rs748586260	p.Arg70Trp	missense variant	-	NC_000007.14:g.16462961G>A	ExAC,gnomAD
rs755457276	p.Arg70Gln	missense variant	-	NC_000007.14:g.16462960C>T	NCI-TCGA
rs755457276	p.Arg70Gln	missense variant	-	NC_000007.14:g.16462960C>T	ExAC,TOPMed,gnomAD
rs749740097	p.Val71Phe	missense variant	-	NC_000007.14:g.16462958C>A	ExAC,TOPMed,gnomAD
rs780030476	p.Gln72Pro	missense variant	-	NC_000007.14:g.16462954T>G	ExAC,gnomAD
rs201667417	p.Val73Ala	missense variant	-	NC_000007.14:g.16462951A>G	ESP,ExAC,TOPMed,gnomAD
rs1314669256	p.Cys75Phe	missense variant	-	NC_000007.14:g.16462945C>A	gnomAD
rs750480433	p.Arg76Gln	missense variant	-	NC_000007.14:g.16462942C>T	ExAC,gnomAD
rs1432584291	p.Arg76Trp	missense variant	-	NC_000007.14:g.16462943G>A	TOPMed,gnomAD
rs767768150	p.Glu77Asp	missense variant	-	NC_000007.14:g.16462938T>G	ExAC,TOPMed
rs752502638	p.Arg79Cys	missense variant	-	NC_000007.14:g.16462934G>A	ExAC,TOPMed,gnomAD
rs1410527496	p.Arg79His	missense variant	-	NC_000007.14:g.16462933C>T	gnomAD
rs765015927	p.Thr81Ala	missense variant	-	NC_000007.14:g.16462928T>C	ExAC,gnomAD
rs759422466	p.Thr81Ile	missense variant	-	NC_000007.14:g.16462927G>A	ExAC,TOPMed
rs776580197	p.Ile84Val	missense variant	-	NC_000007.14:g.16462919T>C	ExAC,gnomAD
rs375054577	p.Gln88Arg	missense variant	-	NC_000007.14:g.16462906T>C	ESP,ExAC,TOPMed,gnomAD
rs1355572419	p.Ile92Val	missense variant	-	NC_000007.14:g.16462895T>C	gnomAD
rs761503585	p.Pro94Ser	missense variant	-	NC_000007.14:g.16462889G>A	ExAC,gnomAD
rs1211991696	p.Glu97Lys	missense variant	-	NC_000007.14:g.16462880C>T	TOPMed
rs1282047291	p.Val99Met	missense variant	-	NC_000007.14:g.16462874C>T	TOPMed
rs1001089128	p.Glu103Lys	missense variant	-	NC_000007.14:g.16462862C>T	gnomAD
rs749784692	p.Pro106Ser	missense variant	-	NC_000007.14:g.16462853G>A	ExAC,TOPMed,gnomAD
rs1186273701	p.Pro106Leu	missense variant	-	NC_000007.14:g.16462852G>A	TOPMed
rs770171919	p.Pro108Ser	missense variant	-	NC_000007.14:g.16462847G>A	ExAC,TOPMed,gnomAD
rs770171919	p.Pro108Ala	missense variant	-	NC_000007.14:g.16462847G>C	ExAC,TOPMed,gnomAD
rs746015616	p.Val109Leu	missense variant	-	NC_000007.14:g.16462844C>G	ExAC,TOPMed,gnomAD
rs1045364308	p.Pro111Ser	missense variant	-	NC_000007.14:g.16462838G>A	-
rs1045364308	p.Pro111Ser	missense variant	-	NC_000007.14:g.16462838G>A	NCI-TCGA
COSM3636901	p.Pro111Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000007.14:g.16462837G>A	NCI-TCGA Cosmic
rs540348040	p.Ile114Thr	missense variant	-	NC_000007.14:g.16462828A>G	1000Genomes,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gly116Ter	stop gained	-	NC_000007.14:g.16462823C>A	NCI-TCGA
NCI-TCGA novel	p.Gly116AlaPheSerTerUnkUnk	frameshift	-	NC_000007.14:g.16462798_16462822CTCCAGTACTTTGTTCCATAGCCTC>-	NCI-TCGA
rs374376320	p.Gly117Ala	missense variant	-	NC_000007.14:g.16462819C>G	ESP,ExAC,gnomAD
rs759245928	p.Thr120Ile	missense variant	-	NC_000007.14:g.16462810G>A	TOPMed
rs759245928	p.Thr120Arg	missense variant	-	NC_000007.14:g.16462810G>C	TOPMed
rs1187447020	p.Lys121Glu	missense variant	-	NC_000007.14:g.16462808T>C	TOPMed,gnomAD
rs1258536161	p.Tyr122Phe	missense variant	-	NC_000007.14:g.16462804T>A	TOPMed,gnomAD
rs778593686	p.Tyr122His	missense variant	-	NC_000007.14:g.16462805A>G	ExAC,gnomAD
rs1336412693	p.Ser124Asn	missense variant	-	NC_000007.14:g.16462798C>T	TOPMed
rs1444384064	p.Arg126Trp	missense variant	-	NC_000007.14:g.16462793T>A	TOPMed
rs1334854475	p.Gln129Ter	stop gained	-	NC_000007.14:g.16462784G>A	gnomAD
rs200731488	p.Gln129Leu	missense variant	-	NC_000007.14:g.16462783T>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1354710489	p.Arg132Gln	missense variant	-	NC_000007.14:g.16462774C>T	gnomAD
rs766402142	p.Cys133Gly	missense variant	-	NC_000007.14:g.16462772A>C	ExAC,gnomAD
rs760672874	p.Cys133Tyr	missense variant	-	NC_000007.14:g.16462771C>T	ExAC,gnomAD
rs143801072	p.Asn135Ser	missense variant	-	NC_000007.14:g.16462765T>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Asp136Tyr	missense variant	-	NC_000007.14:g.16462763C>A	NCI-TCGA
rs761591569	p.Lys137Glu	missense variant	-	NC_000007.14:g.16462760T>C	ExAC,gnomAD
rs1404109418	p.Thr138Ala	missense variant	-	NC_000007.14:g.16462757T>C	gnomAD
rs370368434	p.Arg139Cys	missense variant	-	NC_000007.14:g.16462754G>A	ESP,ExAC,TOPMed,gnomAD
rs370368434	p.Arg139Gly	missense variant	-	NC_000007.14:g.16462754G>C	ESP,ExAC,TOPMed,gnomAD
rs367980297	p.Arg139His	missense variant	-	NC_000007.14:g.16462753C>T	ESP,ExAC,TOPMed,gnomAD
rs367980297	p.Arg139His	missense variant	-	NC_000007.14:g.16462753C>T	NCI-TCGA,NCI-TCGA Cosmic
rs770345144	p.Gln144His	missense variant	-	NC_000007.14:g.16462737C>G	ExAC,gnomAD
rs1186357286	p.Gln146Ter	stop gained	-	NC_000007.14:g.16462733G>A	gnomAD
rs147807617	p.Gln146His	missense variant	-	NC_000007.14:g.16462731C>G	ESP,ExAC,TOPMed,gnomAD
rs964211812	p.Thr152Ala	missense variant	-	NC_000007.14:g.16462715T>C	TOPMed
rs770948074	p.Arg153His	missense variant	-	NC_000007.14:g.16462711C>T	ExAC,TOPMed,gnomAD
rs770948074	p.Arg153His	missense variant	-	NC_000007.14:g.16462711C>T	NCI-TCGA,NCI-TCGA Cosmic
rs758542305	p.Thr154Ile	missense variant	-	NC_000007.14:g.16462708G>A	ExAC,gnomAD
rs751003943	p.Cys163Trp	missense variant	-	NC_000007.14:g.16462680G>C	ExAC,gnomAD
rs1477196083	p.Cys165Ter	stop gained	-	NC_000007.14:g.16462674G>T	TOPMed
COSM1673033	p.Cys165Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000007.14:g.16462675C>T	NCI-TCGA Cosmic
rs763875527	p.Lys166Arg	missense variant	-	NC_000007.14:g.16462672T>C	ExAC,TOPMed,gnomAD
rs1168934593	p.Tyr168Ter	stop gained	-	NC_000007.14:g.16462665G>C	TOPMed,gnomAD
rs1397429710	p.Tyr168Cys	missense variant	-	NC_000007.14:g.16462666T>C	TOPMed
rs780185207	p.Arg170Trp	missense variant	-	NC_000007.14:g.16462661G>A	gnomAD
rs780185207	p.Arg170Trp	missense variant	-	NC_000007.14:g.16462661G>A	NCI-TCGA,NCI-TCGA Cosmic
rs1371917149	p.Gln171Lys	missense variant	-	NC_000007.14:g.16462658G>T	gnomAD
rs775938004	p.Glu174Lys	missense variant	-	NC_000007.14:g.16462649C>T	ExAC,TOPMed,gnomAD
rs775938004	p.Glu174Gln	missense variant	-	NC_000007.14:g.16462649C>G	ExAC,TOPMed,gnomAD
rs191562421	p.His177Arg	missense variant	-	NC_000007.14:g.16462639T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs1467585700	p.Phe179Ile	missense variant	-	NC_000007.14:g.16462634A>T	gnomAD
rs1197098186	p.Met182Ile	missense variant	-	NC_000007.14:g.16462623C>T	gnomAD
rs777170221	p.Met182Thr	missense variant	-	NC_000007.14:g.16462624A>G	ExAC,gnomAD
rs1250735770	p.Ser183Leu	missense variant	-	NC_000007.14:g.16462621G>A	gnomAD
rs771393793	p.Ser183Pro	missense variant	-	NC_000007.14:g.16462622A>G	ExAC,gnomAD
rs772349299	p.Pro184Ser	missense variant	-	NC_000007.14:g.16462619G>A	ExAC,TOPMed,gnomAD
rs772349299	p.Pro184Ala	missense variant	-	NC_000007.14:g.16462619G>C	ExAC,TOPMed,gnomAD
rs755926595	p.Ala185Thr	missense variant	-	NC_000007.14:g.16462616C>T	ExAC,gnomAD
rs745639845	p.Ala185Asp	missense variant	-	NC_000007.14:g.16462615G>T	ExAC
rs755926595	p.Ala185Pro	missense variant	-	NC_000007.14:g.16462616C>G	ExAC,gnomAD
rs757257766	p.Lys186Glu	missense variant	-	NC_000007.14:g.16462613T>C	ExAC
NCI-TCGA novel	p.Lys186Arg	missense variant	-	NC_000007.14:g.16462612T>C	NCI-TCGA
rs1340982183	p.Pro187Thr	missense variant	-	NC_000007.14:g.16462610G>T	TOPMed
rs751139001	p.Val188Ala	missense variant	-	NC_000007.14:g.16462606A>G	ExAC,TOPMed,gnomAD
rs34016012	p.Gln189His	missense variant	-	NC_000007.14:g.16462602C>A	-
rs34016012	p.Gln189His	missense variant	-	NC_000007.14:g.16462602C>A	UniProt,dbSNP
VAR_053682	p.Gln189His	missense variant	-	NC_000007.14:g.16462602C>A	UniProt
rs758100602	p.Gln189Arg	missense variant	-	NC_000007.14:g.16462603T>C	ExAC,TOPMed,gnomAD
rs763456089	p.Gln189Ter	stop gained	-	NC_000007.14:g.16462604G>A	ExAC,gnomAD
rs752242189	p.Glu193Asp	missense variant	-	NC_000007.14:g.16462590C>G	ExAC,gnomAD
rs200096459	p.Arg194Gln	missense variant	-	NC_000007.14:g.16462588C>T	ExAC,TOPMed,gnomAD
rs764846211	p.Arg194Trp	missense variant	-	NC_000007.14:g.16462589G>A	ExAC,gnomAD
rs776972144	p.Ala197Pro	missense variant	-	NC_000007.14:g.16462580C>G	ExAC
rs1001322708	p.Ser198Arg	missense variant	-	NC_000007.14:g.16462575G>T	TOPMed
rs1477484907	p.Ser201Asn	missense variant	-	NC_000007.14:g.16462567C>T	gnomAD
rs761024864	p.Ser201Arg	missense variant	-	NC_000007.14:g.16462566G>T	ExAC,gnomAD
rs1183313450	p.His203Tyr	missense variant	-	NC_000007.14:g.16462562G>A	gnomAD
rs773342048	p.His203Arg	missense variant	-	NC_000007.14:g.16462561T>C	ExAC,gnomAD
rs772009447	p.Ser204Gly	missense variant	-	NC_000007.14:g.16462559T>C	ExAC,TOPMed,gnomAD
rs748429347	p.Met205Val	missense variant	-	NC_000007.14:g.16462556T>C	ExAC,gnomAD
rs375408895	p.Ser206Ile	missense variant	-	NC_000007.14:g.16462552C>A	ESP,ExAC,gnomAD
rs535137743	p.Ter207Tyr	stop lost	-	NC_000007.14:g.16462548C>G	1000Genomes,ExAC,gnomAD

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0003469	Anxiety Disorders	group	BEFREE
C0004153	Atherosclerosis	disease	BEFREE
C0006142	Malignant neoplasm of breast	disease	BEFREE
C0007115	Malignant neoplasm of thyroid	disease	BEFREE
C0007134	Renal Cell Carcinoma	disease	BEFREE
C0010520	Cyanosis	phenotype	BEFREE
C0011265	Presenile dementia	disease	BEFREE
C0011570	Mental Depression	disease	BEFREE
C0011581	Depressive disorder	disease	BEFREE
C0011847	Diabetes	disease	BEFREE
C0011849	Diabetes Mellitus	group	BEFREE
C0014544	Epilepsy	disease	BEFREE
C0017638	Glioma	disease	BEFREE
C0022658	Kidney Diseases	group	BEFREE
C0022660	Kidney Failure, Acute	disease	BEFREE
C0022665	Kidney Neoplasm	disease	BEFREE
C0023434	Chronic Lymphocytic Leukemia	disease	BEFREE
C0024517	Major depression, single episode	disease	BEFREE
C0024530	Malaria	disease	BEFREE
C0024623	Malignant neoplasm of stomach	disease	BEFREE
C0025286	Meningioma	disease	BEFREE
C0027627	Neoplasm Metastasis	phenotype	BEFREE
C0027651	Neoplasms	group	BEFREE
C0027708	Nephroblastoma	disease	BEFREE
C0028756	Obesity, Morbid	disease	BEFREE
C0029001	Onchocerciasis	disease	BEFREE
C0029002	Onchocerciasis, Ocular	disease	BEFREE
C0029408	Degenerative polyarthritis	disease	BEFREE
C0030319	Panic Disorder	disease	BEFREE
C0034152	Henoch-Schoenlein Purpura	disease	BEFREE
C0085762	Alcohol abuse	disease	BEFREE
C0086025	Codependency	disease	BEFREE
C0149654	Conduct Disorder	disease	BEFREE
C0153690	Secondary malignant neoplasm of bone	disease	BEFREE
C0178874	Tumor Progression	phenotype	BEFREE
C0239946	Fibrosis, Liver	disease	BEFREE
C0268164	Primary hyperoxaluria, type I	disease	BEFREE
C0279702	Conventional (Clear Cell) Renal Cell Carcinoma	disease	BEFREE
C0282612	Prostatic Intraepithelial Neoplasias	disease	BEFREE
C0333519	Caries (morphologic abnormality)	disease	BEFREE
C0338656	Impaired cognition	disease	BEFREE
C0346957	Disseminated Malignant Neoplasm	phenotype	BEFREE
C0349204	Nonorganic psychosis	disease	BEFREE
C0376358	Malignant neoplasm of prostate	disease	BEFREE
C0497327	Dementia	disease	BEFREE
C0549473	Thyroid carcinoma	disease	BEFREE
C0596263	Carcinogenesis	phenotype	BEFREE
C0598766	Leukemogenesis	disease	BEFREE
C0600139	Prostate carcinoma	disease	BEFREE
C0677898	invasive cancer	phenotype	BEFREE
C0678222	Breast Carcinoma	disease	BEFREE
C0684249	Carcinoma of lung	disease	BEFREE
C0699790	Colon Carcinoma	disease	BEFREE
C0699791	Stomach Carcinoma	disease	BEFREE
C0740457	Malignant neoplasm of kidney	disease	BEFREE
C0752347	Lewy Body Disease	disease	BEFREE
C0850639	premalignant lesion	phenotype	BEFREE
C1140680	Malignant neoplasm of ovary	disease	BEFREE
C1269683	Major Depressive Disorder	disease	BEFREE
C1306459	Primary malignant neoplasm	group	BEFREE
C1306460	Primary malignant neoplasm of lung	disease	BEFREE
C1378703	Renal carcinoma	disease	BEFREE
C1510586	Autism Spectrum Disorders	disease	BEFREE
C1527249	Colorectal Cancer	disease	BEFREE
C1567741	Alport Syndrome	disease	BEFREE
C1762616	Meningioma, benign, no ICD-O subtype	disease	BEFREE
C1832386	Diabetes Mellitus, Transient Neonatal, 1	disease	BEFREE
C2239176	Liver carcinoma	disease	BEFREE
C2267227	Bulimia Nervosa	disease	BEFREE
C2827407	Infectious Otitis Media	disease	BEFREE
C3811918	GRN-related frontotemporal dementia	disease	BEFREE
C3854173	Pre-renal acute kidney injury	disease	BEFREE
C4275179	Young onset Parkinson disease	disease	BEFREE

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0036122	BMP binding	IDA
GO:0098821	BMP receptor activity	IDA

GO:Biological Process

GO ID	GO Term	Evidence
GO:0007389	pattern specification process	IEA
GO:0010454	negative regulation of cell fate commitment	IEA
GO:0016055	Wnt signaling pathway	IEA
GO:0030178	negative regulation of Wnt signaling pathway	IDA
GO:0030509	BMP signaling pathway	IEA
GO:0030514	negative regulation of BMP signaling pathway	IDA
GO:0031069	hair follicle morphogenesis	IEA
GO:0042475	odontogenesis of dentin-containing tooth	IEA
GO:0045662	negative regulation of myoblast differentiation	IDA
GO:0060648	mammary gland bud morphogenesis	IEA
GO:0090090	negative regulation of canonical Wnt signaling pathway	IEA
GO:2000016	negative regulation of determination of dorsal identity	IDA

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0005615	extracellular space	IDA

Reactome Pathway

Reactome ID	Reactome Term	Evidence

Drugs and compounds information

ID	Drug Name	Action	PubMed
C006718	1,12-benzoperylene	1,12-benzoperylene results in increased expression of SOSTDC1 mRNA	26377693
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in decreased expression of SOSTDC1 mRNA	28801915
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in increased methylation of SOSTDC1 gene	28801915
C029790	2,2',3',4,4',5-hexachlorobiphenyl	[2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with PCB 180] results in decreased expression of SOSTDC1 mRNA	25510870
C111118	2',3,3',4',5-pentachloro-4-hydroxybiphenyl	2',3,3',4',5-pentachloro-4-hydroxybiphenyl results in decreased expression of SOSTDC1 mRNA	19114083
C081766	2,4,4'-trichlorobiphenyl	[2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with PCB 180] results in decreased expression of SOSTDC1 mRNA	25510870
C014024	2,4,5,2',4',5'-hexachlorobiphenyl	[2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with PCB 180] results in decreased expression of SOSTDC1 mRNA	25510870
C009828	2,4,5,2',5'-pentachlorobiphenyl	[2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with PCB 180] results in decreased expression of SOSTDC1 mRNA	25510870
C009407	2,5,2',5'-tetrachlorobiphenyl	[2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with PCB 180] results in decreased expression of SOSTDC1 mRNA	25510870
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of SOSTDC1 mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of SOSTDC1 mRNA	27188386
C105260	4-tert-octylphenol	4-tert-octylphenol results in decreased expression of SOSTDC1 mRNA	17011747
C105260	4-tert-octylphenol	4-tert-octylphenol results in increased expression of SOSTDC1 mRNA	17011747
C496492	abrine	abrine results in increased expression of SOSTDC1 mRNA	22595364
D016604	Aflatoxin B1	Aflatoxin B1 results in increased methylation of SOSTDC1 gene	27153756
D000535	Aluminum	[APP protein modified form binds to Aluminum] which results in decreased expression of SOSTDC1 mRNA	21298039
D000643	Ammonium Chloride	Ammonium Chloride affects the expression of SOSTDC1 mRNA	16483693
D000077237	Arsenic Trioxide	Arsenic Trioxide results in decreased expression of SOSTDC1 mRNA	26705709
D001564	Benzo(a)pyrene	AHR protein affects the reaction [Benzo(a)pyrene affects the expression of SOSTDC1 mRNA]	22228805
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in decreased expression of SOSTDC1 mRNA	22228805
D001622	Betaine	Betaine results in increased expression of SOSTDC1 mRNA	26391144
C543008	bis(4-hydroxyphenyl)sulfone	bis(4-hydroxyphenyl)sulfone results in increased expression of SOSTDC1 mRNA	30951980
C006780	bisphenol A	bisphenol A results in increased expression of SOSTDC1 mRNA	30951980
C006780	bisphenol A	bisphenol A results in decreased expression of SOSTDC1 mRNA	25181051; 29097150;
C000611646	bisphenol F	bisphenol F results in increased expression of SOSTDC1 mRNA	30951980
D002211	Capsaicin	Capsaicin results in increased expression of SOSTDC1 mRNA	20349343
D002737	Chloroprene	Chloroprene results in increased expression of SOSTDC1 mRNA	23125180
D002922	Ciguatoxins	Ciguatoxins affects the expression of SOSTDC1 mRNA	18353800
D003300	Copper	Copper deficiency results in increased expression of SOSTDC1 mRNA	26033743
C010902	decabromobiphenyl ether	decabromobiphenyl ether affects the expression of SOSTDC1 mRNA	24834073
D003976	Diazinon	Diazinon results in decreased expression of SOSTDC1 mRNA	29108742
D003993	Dibutyl Phthalate	Dibutyl Phthalate results in decreased expression of SOSTDC1 mRNA	17361019; 21266533;
D003993	Dibutyl Phthalate	Dibutyl Phthalate results in decreased expression of SOSTDC1 mRNA	21266533
D019422	Dietary Sucrose	Dietary Sucrose results in increased expression of SOSTDC1 mRNA	26033743
D004054	Diethylstilbestrol	Diethylstilbestrol results in decreased expression of SOSTDC1 mRNA	17011747
D004054	Diethylstilbestrol	Diethylstilbestrol results in increased expression of SOSTDC1 mRNA	17011747
C516138	dorsomorphin	[NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of SOSTDC1 mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of SOSTDC1 mRNA	27188386
C118739	entinostat	entinostat results in decreased expression of SOSTDC1 mRNA	26272509
C118739	entinostat	[NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of SOSTDC1 mRNA	27188386
D004958	Estradiol	Estradiol affects the expression of SOSTDC1 mRNA	14699072
D004958	Estradiol	[Estradiol co-treated with TGFB1 protein] results in decreased expression of SOSTDC1 mRNA	30165855
D004997	Ethinyl Estradiol	Ethinyl Estradiol affects the expression of SOSTDC1 mRNA	26865667
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in decreased expression of SOSTDC1 mRNA	17557909; 29097150;
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in decreased expression of SOSTDC1 mRNA	23129252
C061365	flusilazole	flusilazole results in increased expression of SOSTDC1 mRNA	28263823
C039281	furan	furan results in increased methylation of SOSTDC1 gene	22079235
D019833	Genistein	Genistein affects the expression of SOSTDC1 mRNA	26865667
C004312	glycidol	glycidol results in increased expression of SOSTDC1 mRNA	24395379
C561695	(+)-JQ1 compound	(+)-JQ1 compound results in decreased expression of SOSTDC1 mRNA	26752646
C008261	lead acetate	lead acetate results in decreased expression of SOSTDC1 mRNA	22609695
D008345	Manganese	Manganese results in decreased expression of SOSTDC1 mRNA	26745496
C025340	manganese chloride	manganese chloride results in decreased expression of SOSTDC1 mRNA	26745496
C025340	manganese chloride	manganese chloride results in increased methylation of SOSTDC1 gene	28801915
D015122	Mercaptopurine	Mercaptopurine results in decreased expression of SOSTDC1 mRNA	23358152
D009532	Nickel	Nickel results in decreased expression of SOSTDC1 mRNA	24768652; 25583101;
C410127	PCB 180	[2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with PCB 180] results in decreased expression of SOSTDC1 mRNA	25510870
C086401	pentabromodiphenyl ether	pentabromodiphenyl ether results in decreased expression of SOSTDC1 mRNA	26705709
C006253	pirinixic acid	[pirinixic acid binds to and results in increased activity of PPARA protein] which results in decreased expression of SOSTDC1 mRNA	19710929
C006253	pirinixic acid	[pirinixic acid co-treated with PPARA] results in decreased expression of SOSTDC1 mRNA	20813756
C006253	pirinixic acid	pirinixic acid results in decreased expression of SOSTDC1 mRNA	20813756
D011374	Progesterone	Progesterone results in decreased expression of SOSTDC1 mRNA	23018184
D011441	Propylthiouracil	Propylthiouracil results in increased expression of SOSTDC1 mRNA	24780913
C009277	sodium arsenate	sodium arsenate results in increased expression of SOSTDC1 mRNA	21795629
C016104	sodium bichromate	sodium bichromate results in decreased expression of SOSTDC1 mRNA	22561333
D012969	Sodium Fluoride	Sodium Fluoride results in increased expression of SOSTDC1 mRNA	27862939
D013629	Tamoxifen	Tamoxifen affects the expression of SOSTDC1 mRNA	14699072
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin affects the expression of SOSTDC1 mRNA	21570461
C009495	titanium dioxide	titanium dioxide results in decreased expression of SOSTDC1 mRNA	30012374
D014050	Toluene	Toluene results in decreased expression of SOSTDC1 mRNA	22967744
D014212	Tretinoin	Tretinoin results in increased expression of SOSTDC1 mRNA	21934132
C012589	trichostatin A	trichostatin A results in increased expression of SOSTDC1 mRNA	24935251
D014635	Valproic Acid	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of SOSTDC1 mRNA	27188386
D014635	Valproic Acid	Valproic Acid affects the expression of SOSTDC1 mRNA	25979313
D014635	Valproic Acid	Valproic Acid results in increased expression of SOSTDC1 mRNA	23179753; 24383497; 24935251; 26272509; 27188386; 28001369;
D014635	Valproic Acid	Valproic Acid affects the expression of SOSTDC1 mRNA	17963808
D001335	Vehicle Emissions	Vehicle Emissions affects the methylation of SOSTDC1 gene	25560391
C029297	vinylidene chloride	vinylidene chloride results in decreased expression of SOSTDC1 mRNA	26682919
D000077337	Vorinostat	Vorinostat results in increased expression of SOSTDC1 mRNA	27188386
D000077211	Zoledronic Acid	Zoledronic Acid results in increased expression of SOSTDC1 mRNA	24714768

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0025	Alternative splicing
KW-0903	Direct protein sequencing
KW-1015	Disulfide bond
KW-0325	Glycoprotein
KW-0621	Polymorphism
KW-1185	Reference proteome
KW-0964	Secreted
KW-0732	Signal
KW-0879	Wnt signaling pathway

Interpro

InterPro ID	InterPro Term
IPR006207	Cys_knot_C
IPR029034	Cystine-knot_cytokine
IPR008835	Sclerostin/SOSTDC1

PROSITE

PROSITE ID	PROSITE Term
PS01225	CTCK_2

Pfam

Pfam ID	Pfam Term
PF05463	Sclerostin