CleftGeneDB-Search

Gene: SLC32A1

Basic information

Tag	Content
Uniprot ID	Q9H598; Q8N489;
Entrez ID	140679
Genbank protein ID	AAH53582.1; BAB70846.1; AAH36458.2; AAK98782.1;
Genbank nucleotide ID	NM_080552.2
Ensembl protein ID	ENSP00000217420
Ensembl nucleotide ID	ENSG00000101438
Gene name	Vesicular inhibitory amino acid transporter
Gene symbol	SLC32A1
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type
Developmental stage
Data sources	Homology search
Reference
Functional description	Involved in the uptake of GABA and glycine into the synaptic vesicles.
Sequence	MATLLRSKLS NVATSVSNKS QAKMSGMFAR MGFQAATDEE AVGFAHCDDL DFEHRQGLQM 60 DILKAEGEPC GDEGAEAPVE GDIHYQRGSG APLPPSGSKD QVGGGGEFGG HDKPKITAWE 120 AGWNVTNAIQ GMFVLGLPYA ILHGGYLGLF LIIFAAVVCC YTGKILIACL YEENEDGEVV 180 RVRDSYVAIA NACCAPRFPT LGGRVVNVAQ IIELVMTCIL YVVVSGNLMY NSFPGLPVSQ 240 KSWSIIATAV LLPCAFLKNL KAVSKFSLLC TLAHFVINIL VIAYCLSRAR DWAWEKVKFY 300 IDVKKFPISI GIIVFSYTSQ IFLPSLEGNM QQPSEFHCMM NWTHIAACVL KGLFALVAYL 360 TWADETKEVI TDNLPGSIRA VVNIFLVAKA LLSYPLPFFA AVEVLEKSLF QEGSRAFFPA 420 CYSGDGRLKS WGLTLRCALV VFTLLMAIYV PHFALLMGLT GSLTGAGLCF LLPSLFHLRL 480 LWRKLLWHQV FFDVAIFVIG GICSVSGFVH SLEGLIEAYR TNAED 525

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

There is no related protein structure for this gene.

Protein disorder information

Orthologous information

Relation	Gene symbol	Entrez ID	UniProt ID	Cleft type	Developmental stage	Species	Evidence	Details
1:1 ortholog	SLC32A1	100301361	G3N354			Bos taurus	Prediction	More>>
1:1 ortholog	SLC32A1	485870	E2QU68			Canis lupus familiaris	Prediction	More>>
1:1 ortholog	SLC32A1	102180509	A0A452E4X8			Capra hircus	Prediction	More>>
1:1 ortholog	SLC32A1	140679	Q9H598			Homo sapiens	Prediction	More>>
1:1 ortholog	Slc32a1	22348	O35633	CPO	E14.5	Mus musculus	Publication	More>>
1:1 ortholog	SLC32A1	469940	H2QKC6			Pan troglodytes	Prediction	More>>
1:1 ortholog	SLC32A1	100517013	F1SDX2			Sus scrofa	Prediction	More>>
1:1 ortholog	SLC32A1		U3KMK1			Oryctolagus cuniculus	Prediction	More>>
1:1 ortholog	Slc32a1	83612	O35458			Rattus norvegicus	Prediction	More>>
1:1 ortholog	slc32a1	798575	A1L1T3			Danio rerio	Prediction	More>>

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
NCI-TCGA novel	p.Ala2Thr	missense variant	-	NC_000020.11:g.38724728G>A	NCI-TCGA
rs757775261	p.Thr3Asn	missense variant	-	NC_000020.11:g.38724732C>A	ExAC,gnomAD
rs779446777	p.Leu4Phe	missense variant	-	NC_000020.11:g.38724736G>T	ExAC,gnomAD
rs746574042	p.Leu5Ile	missense variant	-	NC_000020.11:g.38724737C>A	ExAC,gnomAD
rs776050127	p.Arg6Cys	missense variant	-	NC_000020.11:g.38724740C>T	NCI-TCGA,NCI-TCGA Cosmic
NCI-TCGA novel	p.Arg6Ser	missense variant	-	NC_000020.11:g.38724740C>A	NCI-TCGA
rs376758221	p.Arg6His	missense variant	-	NC_000020.11:g.38724741G>A	ESP,TOPMed,gnomAD
rs376758221	p.Arg6Leu	missense variant	-	NC_000020.11:g.38724741G>T	ESP,TOPMed,gnomAD
rs776050127	p.Arg6Cys	missense variant	-	NC_000020.11:g.38724740C>T	ExAC,gnomAD
rs1327082135	p.Lys8Glu	missense variant	-	NC_000020.11:g.38724746A>G	gnomAD
NCI-TCGA novel	p.Asn11ThrPheSerTerUnkUnk	frameshift	-	NC_000020.11:g.38724753C>-	NCI-TCGA
rs747808159	p.Val12Met	missense variant	-	NC_000020.11:g.38724758G>A	ExAC,gnomAD
rs1373584121	p.Ala13Val	missense variant	-	NC_000020.11:g.38724762C>T	gnomAD
rs1271036386	p.Val16Leu	missense variant	-	NC_000020.11:g.38724770G>C	gnomAD
rs1336592004	p.Ser17Phe	missense variant	-	NC_000020.11:g.38724774C>T	gnomAD
rs894838964	p.Asn18Lys	missense variant	-	NC_000020.11:g.38724778C>G	TOPMed
rs977047799	p.Ala22Val	missense variant	-	NC_000020.11:g.38724789C>T	TOPMed,gnomAD
rs769470578	p.Ala22Thr	missense variant	-	NC_000020.11:g.38724788G>A	ExAC,TOPMed,gnomAD
rs772946332	p.Met24Ile	missense variant	-	NC_000020.11:g.38724796G>A	ExAC,TOPMed,gnomAD
rs762777530	p.Gly26Ser	missense variant	-	NC_000020.11:g.38724800G>A	ExAC,TOPMed,gnomAD
rs766274199	p.Gly26Val	missense variant	-	NC_000020.11:g.38724801G>T	ExAC,TOPMed,gnomAD
rs774450761	p.Met27Ile	missense variant	-	NC_000020.11:g.38724805G>A	ExAC,TOPMed,gnomAD
rs1234723662	p.Met27Val	missense variant	-	NC_000020.11:g.38724803A>G	TOPMed,gnomAD
rs759507627	p.Ala29Ser	missense variant	-	NC_000020.11:g.38724809G>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Met31Lys	missense variant	-	NC_000020.11:g.38724816T>A	NCI-TCGA
rs966485237	p.Met31Ile	missense variant	-	NC_000020.11:g.38724817G>A	TOPMed
rs1415955522	p.Gly32Ser	missense variant	-	NC_000020.11:g.38724818G>A	gnomAD
COSM3799522	p.Gln34Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000020.11:g.38724824C>T	NCI-TCGA Cosmic
rs1164217464	p.Ala35Glu	missense variant	-	NC_000020.11:g.38724828C>A	gnomAD
rs752767012	p.Thr37Ala	missense variant	-	NC_000020.11:g.38724833A>G	ExAC,TOPMed,gnomAD
rs780236153	p.Thr37Met	missense variant	-	NC_000020.11:g.38724834C>T	TOPMed,gnomAD
rs780236153	p.Thr37Lys	missense variant	-	NC_000020.11:g.38724834C>A	TOPMed,gnomAD
rs764377141	p.Asp38Gly	missense variant	-	NC_000020.11:g.38724837A>G	ExAC,gnomAD
NCI-TCGA novel	p.Glu39Lys	missense variant	-	NC_000020.11:g.38724839G>A	NCI-TCGA
rs201398803	p.Glu39Gly	missense variant	-	NC_000020.11:g.38724840A>G	ESP,ExAC,TOPMed,gnomAD
COSM3546232	p.Glu40Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38724842G>A	NCI-TCGA Cosmic
rs757622373	p.Ala41Val	missense variant	-	NC_000020.11:g.38724846C>T	ExAC,gnomAD
rs1233632821	p.Val42Leu	missense variant	-	NC_000020.11:g.38724848G>T	gnomAD
rs1337342975	p.Phe44Leu	missense variant	-	NC_000020.11:g.38724856C>A	gnomAD
COSM4727128	p.Ala45Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38724858C>T	NCI-TCGA Cosmic
rs1323079141	p.His46Arg	missense variant	-	NC_000020.11:g.38724861A>G	gnomAD
COSM270789	p.Asp48Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38724866G>A	NCI-TCGA Cosmic
rs1275197837	p.Leu50Val	missense variant	-	NC_000020.11:g.38724872C>G	gnomAD
rs1324797313	p.Asp51Gly	missense variant	-	NC_000020.11:g.38724876A>G	TOPMed,gnomAD
rs758842716	p.Glu53Ala	missense variant	-	NC_000020.11:g.38724882A>C	ExAC,gnomAD
NCI-TCGA novel	p.Arg55Ser	missense variant	-	NC_000020.11:g.38724887C>A	NCI-TCGA
rs1255607270	p.Arg55Leu	missense variant	-	NC_000020.11:g.38724888G>T	gnomAD
rs1430070291	p.Gln56Leu	missense variant	-	NC_000020.11:g.38724891A>T	gnomAD
rs769370986	p.Gly57Asp	missense variant	-	NC_000020.11:g.38724894G>A	ExAC,TOPMed,gnomAD
rs769370986	p.Gly57Val	missense variant	-	NC_000020.11:g.38724894G>T	ExAC,TOPMed,gnomAD
rs772898796	p.Gln59Arg	missense variant	-	NC_000020.11:g.38724900A>G	ExAC,gnomAD
rs1474713163	p.Asp61His	missense variant	-	NC_000020.11:g.38724905G>C	gnomAD
rs918705697	p.Lys64Glu	missense variant	-	NC_000020.11:g.38724914A>G	TOPMed,gnomAD
rs1391341786	p.Ala65Thr	missense variant	-	NC_000020.11:g.38724917G>A	TOPMed,gnomAD
COSM5076620	p.Glu66Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38724920G>A	NCI-TCGA Cosmic
rs1433508942	p.Glu66Asp	missense variant	-	NC_000020.11:g.38724922G>C	gnomAD
rs748843338	p.Gly67Glu	missense variant	-	NC_000020.11:g.38724924G>A	NCI-TCGA,NCI-TCGA Cosmic
rs748843338	p.Gly67Glu	missense variant	-	NC_000020.11:g.38724924G>A	ExAC,gnomAD
rs1165613944	p.Gly67Arg	missense variant	-	NC_000020.11:g.38724923G>C	TOPMed
rs770789897	p.Glu68Lys	missense variant	-	NC_000020.11:g.38724926G>A	ExAC,gnomAD
rs1396298373	p.Pro69Ser	missense variant	-	NC_000020.11:g.38724929C>T	TOPMed,gnomAD
rs759562550	p.Asp72Glu	missense variant	-	NC_000020.11:g.38724940C>G	ExAC,TOPMed,gnomAD
rs775782051	p.Glu73Lys	missense variant	-	NC_000020.11:g.38724941G>A	NCI-TCGA Cosmic
rs775782051	p.Glu73Gln	missense variant	-	NC_000020.11:g.38724941G>C	ExAC,TOPMed,gnomAD
rs775782051	p.Glu73Lys	missense variant	-	NC_000020.11:g.38724941G>A	ExAC,TOPMed,gnomAD
rs1483624176	p.Gly74Asp	missense variant	-	NC_000020.11:g.38724945G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Gly74GluPheSerTerUnkUnk	frameshift	-	NC_000020.11:g.38724943_38724964GGGCGCTGAAGCGCCCGTCGAG>-	NCI-TCGA
rs1483624176	p.Gly74Asp	missense variant	-	NC_000020.11:g.38724945G>A	TOPMed
rs148951877	p.Ala75Ser	missense variant	-	NC_000020.11:g.38724947G>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs148951877	p.Ala75Thr	missense variant	-	NC_000020.11:g.38724947G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1347085642	p.Glu76Lys	missense variant	-	NC_000020.11:g.38724950G>A	gnomAD
rs1347085642	p.Glu76Lys	missense variant	-	NC_000020.11:g.38724950G>A	NCI-TCGA
NCI-TCGA novel	p.Ala77Gly	missense variant	-	NC_000020.11:g.38724954C>G	NCI-TCGA
rs754116848	p.Pro78Ser	missense variant	-	NC_000020.11:g.38724956C>T	ExAC,gnomAD
COSM6159767	p.Val79Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38724959G>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Glu80Lys	missense variant	-	NC_000020.11:g.38724962G>A	NCI-TCGA
rs376820879	p.Ile83Leu	missense variant	-	NC_000020.11:g.38724971A>C	ESP,ExAC,gnomAD
rs376820879	p.Ile83Phe	missense variant	-	NC_000020.11:g.38724971A>T	ESP,ExAC,gnomAD
rs370067437	p.His84Tyr	missense variant	-	NC_000020.11:g.38724974C>T	ESP,ExAC,gnomAD
COSM4098273	p.Gly88Asp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38724987G>A	NCI-TCGA Cosmic
rs1322496611	p.Pro94Ser	missense variant	-	NC_000020.11:g.38725004C>T	gnomAD
COSM3799523	p.Pro94Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38725005C>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Pro95Ser	missense variant	-	NC_000020.11:g.38725007C>T	NCI-TCGA
rs551108790	p.Pro95Leu	missense variant	-	NC_000020.11:g.38725008C>T	1000Genomes,ExAC,gnomAD
rs1466225482	p.Gly97Ser	missense variant	-	NC_000020.11:g.38725013G>A	NCI-TCGA Cosmic
rs1466225482	p.Gly97Ser	missense variant	-	NC_000020.11:g.38725013G>A	gnomAD
rs1055910462	p.Ser98Cys	missense variant	-	NC_000020.11:g.38725017C>G	TOPMed,gnomAD
COSM3546233	p.Asp100Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38725022G>A	NCI-TCGA Cosmic
rs1157562457	p.Gln101Leu	missense variant	-	NC_000020.11:g.38725026A>T	TOPMed,gnomAD
rs752195345	p.Val102Glu	missense variant	-	NC_000020.11:g.38725029T>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gly106AlaPheSerTerUnkUnk	frameshift	-	NC_000020.11:g.38725040G>-	NCI-TCGA
rs748975423	p.Glu107Lys	missense variant	-	NC_000020.11:g.38725043G>A	NCI-TCGA,NCI-TCGA Cosmic
rs748975423	p.Glu107Lys	missense variant	-	NC_000020.11:g.38725043G>A	ExAC,gnomAD
NCI-TCGA novel	p.Asp112Asn	missense variant	-	NC_000020.11:g.38725058G>A	NCI-TCGA
rs775548792	p.Lys113Arg	missense variant	-	NC_000020.11:g.38725062A>G	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ile116Met	missense variant	-	NC_000020.11:g.38725072C>G	NCI-TCGA
COSM3546234	p.Trp119Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000020.11:g.38725081G>A	NCI-TCGA Cosmic
rs527517348	p.Asn127Ser	missense variant	-	NC_000020.11:g.38725104A>G	1000Genomes,ExAC,gnomAD
rs1292846379	p.Ile129Ser	missense variant	-	NC_000020.11:g.38725110T>G	TOPMed
rs762148090	p.Ile129Val	missense variant	-	NC_000020.11:g.38725109A>G	ExAC,gnomAD
rs1461040126	p.Gln130His	missense variant	-	NC_000020.11:g.38725114G>C	TOPMed
rs1484509288	p.Gly131Asp	missense variant	-	NC_000020.11:g.38727453G>A	NCI-TCGA
rs1256321919	p.Gly131Ser	missense variant	-	NC_000020.11:g.38727452G>A	gnomAD
rs1484509288	p.Gly131Asp	missense variant	-	NC_000020.11:g.38727453G>A	gnomAD
rs1189773827	p.Leu135Val	missense variant	-	NC_000020.11:g.38727464C>G	TOPMed,gnomAD
rs1168149433	p.Pro138Leu	missense variant	-	NC_000020.11:g.38727474C>T	gnomAD
COSM1026690	p.Tyr139Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38727477A>G	NCI-TCGA Cosmic
rs1431652117	p.Ala140Thr	missense variant	-	NC_000020.11:g.38727479G>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ala140Val	missense variant	-	NC_000020.11:g.38727480C>T	NCI-TCGA
rs1431652117	p.Ala140Thr	missense variant	-	NC_000020.11:g.38727479G>A	gnomAD
rs748027578	p.His143Tyr	missense variant	-	NC_000020.11:g.38727488C>T	ExAC,TOPMed,gnomAD
rs769891542	p.His143Arg	missense variant	-	NC_000020.11:g.38727489A>G	ExAC,gnomAD
NCI-TCGA novel	p.Gly144Asp	missense variant	-	NC_000020.11:g.38727492G>A	NCI-TCGA
rs1304945532	p.Gly144Arg	missense variant	-	NC_000020.11:g.38727491G>C	gnomAD
NCI-TCGA novel	p.Gly145Ala	missense variant	-	NC_000020.11:g.38727495G>C	NCI-TCGA
rs1380430578	p.Gly145Arg	missense variant	-	NC_000020.11:g.38727494G>C	gnomAD
COSM263706	p.Gly145Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38727494G>T	NCI-TCGA Cosmic
rs749524268	p.Tyr146Phe	missense variant	-	NC_000020.11:g.38727498A>T	ExAC,gnomAD
rs1279053628	p.Gly148Glu	missense variant	-	NC_000020.11:g.38727504G>A	gnomAD
rs774846233	p.Leu151Val	missense variant	-	NC_000020.11:g.38727512C>G	ExAC,gnomAD
rs1490682237	p.Ile152Phe	missense variant	-	NC_000020.11:g.38727515A>T	gnomAD
rs1485387558	p.Ile153Val	missense variant	-	NC_000020.11:g.38727518A>G	gnomAD
COSM268152	p.Ala155Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38727524G>A	NCI-TCGA Cosmic
rs768121561	p.Val157Ile	missense variant	-	NC_000020.11:g.38727530G>A	ExAC,gnomAD
rs1219832962	p.Val158Met	missense variant	-	NC_000020.11:g.38727533G>A	gnomAD
rs1450043884	p.Val158Gly	missense variant	-	NC_000020.11:g.38727534T>G	gnomAD
NCI-TCGA novel	p.Gly163Ser	missense variant	-	NC_000020.11:g.38727548G>A	NCI-TCGA
rs761227662	p.Ala168Thr	missense variant	-	NC_000020.11:g.38727563G>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ala168Gly	missense variant	-	NC_000020.11:g.38727564C>G	NCI-TCGA
rs761227662	p.Ala168Ser	missense variant	-	NC_000020.11:g.38727563G>T	ExAC,TOPMed,gnomAD
rs968205956	p.Ala168Val	missense variant	-	NC_000020.11:g.38727564C>T	TOPMed
rs968205956	p.Ala168Val	missense variant	-	NC_000020.11:g.38727564C>T	NCI-TCGA Cosmic
rs764847103	p.Glu172Gln	missense variant	-	NC_000020.11:g.38727575G>C	ExAC,gnomAD
rs758187434	p.Glu172Gly	missense variant	-	NC_000020.11:g.38727576A>G	ExAC,gnomAD
rs764847103	p.Glu172Lys	missense variant	-	NC_000020.11:g.38727575G>A	ExAC,gnomAD
rs377010570	p.Glu173Gln	missense variant	-	NC_000020.11:g.38727578G>C	ESP,ExAC,TOPMed,gnomAD
rs1302059218	p.Glu173Asp	missense variant	-	NC_000020.11:g.38727580G>C	gnomAD
rs759565716	p.Asn174Lys	missense variant	-	NC_000020.11:g.38727583T>A	ExAC,TOPMed,gnomAD
rs759565716	p.Asn174Lys	missense variant	-	NC_000020.11:g.38727583T>G	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Glu175Ter	stop gained	-	NC_000020.11:g.38727584G>T	NCI-TCGA
rs780997867	p.Asp176Glu	missense variant	-	NC_000020.11:g.38727589C>A	ExAC,TOPMed,gnomAD
rs1220464417	p.Asp176Asn	missense variant	-	NC_000020.11:g.38727587G>A	gnomAD
rs780997867	p.Asp176Glu	missense variant	-	NC_000020.11:g.38727589C>G	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gly177Asp	missense variant	-	NC_000020.11:g.38727591G>A	NCI-TCGA
rs1051897820	p.Gly177Ala	missense variant	-	NC_000020.11:g.38727591G>C	gnomAD
rs752635600	p.Gly177Ser	missense variant	-	NC_000020.11:g.38727590G>A	ExAC,gnomAD
COSM6093130	p.Glu178Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000020.11:g.38727593G>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Arg181His	missense variant	-	NC_000020.11:g.38727603G>A	NCI-TCGA
NCI-TCGA novel	p.Arg181Cys	missense variant	-	NC_000020.11:g.38727602C>T	NCI-TCGA
NCI-TCGA novel	p.Arg183Pro	missense variant	-	NC_000020.11:g.38727609G>C	NCI-TCGA
NCI-TCGA novel	p.Arg183Trp	missense variant	-	NC_000020.11:g.38727608C>T	NCI-TCGA
rs1313408853	p.Asp184Asn	missense variant	-	NC_000020.11:g.38727611G>A	TOPMed
rs1251065489	p.Ser185Thr	missense variant	-	NC_000020.11:g.38727614T>A	gnomAD
rs777888313	p.Tyr186Ter	stop gained	-	NC_000020.11:g.38727619C>A	ExAC,gnomAD
rs1362640908	p.Val187Leu	missense variant	-	NC_000020.11:g.38727620G>T	gnomAD
rs1465427136	p.Val187Glu	missense variant	-	NC_000020.11:g.38727621T>A	TOPMed
rs1358670501	p.Ile189Thr	missense variant	-	NC_000020.11:g.38727627T>C	TOPMed
rs922868461	p.Ala190Gly	missense variant	-	NC_000020.11:g.38727630C>G	TOPMed
rs1400399949	p.Ala190Thr	missense variant	-	NC_000020.11:g.38727629G>A	gnomAD
rs749366553	p.Ala192Asp	missense variant	-	NC_000020.11:g.38727636C>A	ExAC,gnomAD
rs140808070	p.Cys193Phe	missense variant	-	NC_000020.11:g.38727639G>T	ESP,ExAC,gnomAD
rs1411899232	p.Cys194Ser	missense variant	-	NC_000020.11:g.38727641T>A	TOPMed
COSM4098279	p.Cys194Gly	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38727641T>G	NCI-TCGA Cosmic
rs778982202	p.Ala195Thr	missense variant	-	NC_000020.11:g.38727644G>A	ExAC,TOPMed,gnomAD
rs778982202	p.Ala195Ser	missense variant	-	NC_000020.11:g.38727644G>T	ExAC,TOPMed,gnomAD
rs778982202	p.Ala195Thr	missense variant	-	NC_000020.11:g.38727644G>A	NCI-TCGA Cosmic
rs772357025	p.Pro196Leu	missense variant	-	NC_000020.11:g.38727648C>T	ExAC,gnomAD
rs1274967586	p.Pro196Ser	missense variant	-	NC_000020.11:g.38727647C>T	TOPMed,gnomAD
COSM6093129	p.Pro196Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38727647C>A	NCI-TCGA Cosmic
COSM1411716	p.Arg197Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38727650C>T	NCI-TCGA Cosmic
rs775935038	p.Pro199Leu	missense variant	-	NC_000020.11:g.38727657C>T	ExAC,TOPMed,gnomAD
COSM4098280	p.Pro199Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38727657C>G	NCI-TCGA Cosmic
rs761280843	p.Thr200Arg	missense variant	-	NC_000020.11:g.38727660C>G	ExAC,TOPMed,gnomAD
rs761280843	p.Thr200Met	missense variant	-	NC_000020.11:g.38727660C>T	ExAC,TOPMed,gnomAD
rs761280843	p.Thr200Lys	missense variant	-	NC_000020.11:g.38727660C>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Leu201Met	missense variant	-	NC_000020.11:g.38727662C>A	NCI-TCGA
COSM6093128	p.Gly202Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38727665G>A	NCI-TCGA Cosmic
rs767228334	p.Val205Met	missense variant	-	NC_000020.11:g.38727674G>A	ExAC,gnomAD
rs201506462	p.Asn207Lys	missense variant	-	NC_000020.11:g.38727682C>A	1000Genomes,ExAC,gnomAD
NCI-TCGA novel	p.Val208Ile	missense variant	-	NC_000020.11:g.38727683G>A	NCI-TCGA
rs756110955	p.Val208Ala	missense variant	-	NC_000020.11:g.38727684T>C	ExAC,gnomAD
COSM1411717	p.Ala209Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38727687C>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ile211Phe	missense variant	-	NC_000020.11:g.38727692A>T	NCI-TCGA
NCI-TCGA novel	p.Glu213Gly	missense variant	-	NC_000020.11:g.38727699A>G	NCI-TCGA
rs1323625630	p.Ile219Thr	missense variant	-	NC_000020.11:g.38727717T>C	gnomAD
rs1420501445	p.Ser225Gly	missense variant	-	NC_000020.11:g.38727734A>G	TOPMed
rs567071470	p.Gly226Val	missense variant	-	NC_000020.11:g.38727738G>T	1000Genomes,ExAC,gnomAD
rs1291265376	p.Asn227Ser	missense variant	-	NC_000020.11:g.38727741A>G	gnomAD
rs1165876096	p.Met229Thr	missense variant	-	NC_000020.11:g.38727747T>C	TOPMed
rs769332696	p.Tyr230His	missense variant	-	NC_000020.11:g.38727749T>C	ExAC,gnomAD
rs777297939	p.Leu236Met	missense variant	-	NC_000020.11:g.38727767C>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Pro237Arg	missense variant	-	NC_000020.11:g.38727771C>G	NCI-TCGA
rs1203140609	p.Val238Leu	missense variant	-	NC_000020.11:g.38727773G>T	NCI-TCGA Cosmic
rs1203140609	p.Val238Leu	missense variant	-	NC_000020.11:g.38727773G>T	gnomAD
rs1203140609	p.Val238Leu	missense variant	-	NC_000020.11:g.38727773G>C	gnomAD
NCI-TCGA novel	p.Ser239Pro	missense variant	-	NC_000020.11:g.38727776T>C	NCI-TCGA
rs1254196187	p.Ser239Trp	missense variant	-	NC_000020.11:g.38727777C>G	NCI-TCGA
rs1254196187	p.Ser239Trp	missense variant	-	NC_000020.11:g.38727777C>G	gnomAD
rs759168820	p.Gln240His	missense variant	-	NC_000020.11:g.38727781G>C	ExAC,gnomAD
rs1187650504	p.Ser244Thr	missense variant	-	NC_000020.11:g.38727791T>A	gnomAD
rs767194991	p.Ser244Cys	missense variant	-	NC_000020.11:g.38727792C>G	ExAC,gnomAD
rs1236966151	p.Ile245Leu	missense variant	-	NC_000020.11:g.38727794A>C	TOPMed
COSM5755573	p.Ala247Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38727800G>A	NCI-TCGA Cosmic
COSM186738	p.Thr248Met	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38727804C>T	NCI-TCGA Cosmic
COSM4098281	p.Ala249Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38727806G>A	NCI-TCGA Cosmic
COSM5481590	p.Val250Met	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38727809G>A	NCI-TCGA Cosmic
rs763830019	p.Val250Leu	missense variant	-	NC_000020.11:g.38727809G>C	ExAC,gnomAD
rs753806917	p.Val250Ala	missense variant	-	NC_000020.11:g.38727810T>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Phe256LeuPheSerTerUnk	frameshift	-	NC_000020.11:g.38727824_38727825insC	NCI-TCGA
NCI-TCGA novel	p.Leu257His	missense variant	-	NC_000020.11:g.38727831T>A	NCI-TCGA
rs199839263	p.Asn259Asp	missense variant	-	NC_000020.11:g.38727836A>G	1000Genomes,ExAC,gnomAD
COSM723731	p.Lys261Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38727844G>T	NCI-TCGA Cosmic
rs750507253	p.Ala262Thr	missense variant	-	NC_000020.11:g.38727845G>A	ExAC,gnomAD
rs747176135	p.Lys265Arg	missense variant	-	NC_000020.11:g.38727855A>G	ExAC,gnomAD
rs1361021691	p.Leu269Val	missense variant	-	NC_000020.11:g.38727866C>G	gnomAD
rs752695840	p.Thr271Ala	missense variant	-	NC_000020.11:g.38727872A>G	ExAC,TOPMed,gnomAD
rs748614601	p.Phe275Leu	missense variant	-	NC_000020.11:g.38727886C>A	ExAC,TOPMed,gnomAD
rs748614601	p.Phe275Leu	missense variant	-	NC_000020.11:g.38727886C>G	ExAC,TOPMed,gnomAD
rs1023170011	p.Val276Ile	missense variant	-	NC_000020.11:g.38727887G>A	-
rs1023170011	p.Val276Ile	missense variant	-	NC_000020.11:g.38727887G>A	NCI-TCGA Cosmic
rs867501655	p.Ile277Leu	missense variant	-	NC_000020.11:g.38727890A>C	gnomAD
rs1343123233	p.Ile279Met	missense variant	-	NC_000020.11:g.38727898C>G	TOPMed,gnomAD
rs1377762542	p.Val281Ile	missense variant	-	NC_000020.11:g.38727902G>A	TOPMed
rs371391027	p.Ala283Thr	missense variant	-	NC_000020.11:g.38727908G>A	ESP,ExAC,TOPMed
rs1003447285	p.Tyr284Asn	missense variant	-	NC_000020.11:g.38727911T>A	TOPMed
COSM4098282	p.Tyr284Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38727912A>G	NCI-TCGA Cosmic
rs770948234	p.Cys285Gly	missense variant	-	NC_000020.11:g.38727914T>G	ExAC,gnomAD
NCI-TCGA novel	p.Ser287Pro	missense variant	-	NC_000020.11:g.38727920T>C	NCI-TCGA
rs142717620	p.Arg288Gly	missense variant	-	NC_000020.11:g.38727923C>G	ESP,gnomAD
rs775147981	p.Arg288Gln	missense variant	-	NC_000020.11:g.38727924G>A	ExAC,gnomAD
COSM1411718	p.Arg288Trp	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38727923C>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ala289Val	missense variant	-	NC_000020.11:g.38727927C>T	NCI-TCGA
rs763883310	p.Arg290His	missense variant	-	NC_000020.11:g.38727930G>A	ExAC,TOPMed,gnomAD
COSM6159765	p.Arg290Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38727929C>A	NCI-TCGA Cosmic
rs776433678	p.Asp291Asn	missense variant	-	NC_000020.11:g.38727932G>A	NCI-TCGA,NCI-TCGA Cosmic
rs776433678	p.Asp291Asn	missense variant	-	NC_000020.11:g.38727932G>A	ExAC,gnomAD
rs1403936608	p.Asp291Glu	missense variant	-	NC_000020.11:g.38727934C>G	gnomAD
rs1414787318	p.Ala293Val	missense variant	-	NC_000020.11:g.38727939C>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ala293Asp	missense variant	-	NC_000020.11:g.38727939C>A	NCI-TCGA
rs1414787318	p.Ala293Val	missense variant	-	NC_000020.11:g.38727939C>T	gnomAD
rs761719417	p.Trp294Gly	missense variant	-	NC_000020.11:g.38727941T>G	ExAC,gnomAD
rs1243113122	p.Glu295Asp	missense variant	-	NC_000020.11:g.38727946G>C	gnomAD
COSM3546236	p.Lys296Glu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38727947A>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Phe299Cys	missense variant	-	NC_000020.11:g.38727957T>G	NCI-TCGA
rs200060849	p.Phe299Leu	missense variant	-	NC_000020.11:g.38727958C>A	-
rs200060849	p.Phe299Leu	missense variant	-	NC_000020.11:g.38727958C>A	NCI-TCGA,NCI-TCGA Cosmic
rs1362916582	p.Tyr300His	missense variant	-	NC_000020.11:g.38727959T>C	gnomAD
NCI-TCGA novel	p.Asp302Asn	missense variant	-	NC_000020.11:g.38727965G>A	NCI-TCGA
NCI-TCGA novel	p.Asp302Val	missense variant	-	NC_000020.11:g.38727966A>T	NCI-TCGA
rs1299907122	p.Asp302His	missense variant	-	NC_000020.11:g.38727965G>C	gnomAD
COSM1026695	p.Lys304Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38727973G>T	NCI-TCGA Cosmic
rs750514398	p.Lys305Glu	missense variant	-	NC_000020.11:g.38727974A>G	ExAC,gnomAD
COSM723730	p.Pro307Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38727980C>A	NCI-TCGA Cosmic
rs1290656795	p.Ile310Thr	missense variant	-	NC_000020.11:g.38727990T>C	gnomAD
rs758524437	p.Ile313Met	missense variant	-	NC_000020.11:g.38728000C>G	ExAC,gnomAD
rs1201369045	p.Val314Met	missense variant	-	NC_000020.11:g.38728001G>A	gnomAD
rs1284084095	p.Ser316Gly	missense variant	-	NC_000020.11:g.38728007A>G	gnomAD
COSM6093127	p.Ser316Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728007A>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Tyr317Cys	missense variant	-	NC_000020.11:g.38728011A>G	NCI-TCGA
NCI-TCGA novel	p.Thr318Lys	missense variant	-	NC_000020.11:g.38728014C>A	NCI-TCGA
rs1161925841	p.Ile321Val	missense variant	-	NC_000020.11:g.38728022A>G	TOPMed
COSM4098283	p.Ser325Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728035C>T	NCI-TCGA Cosmic
COSM3546238	p.Gly328Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728043G>A	NCI-TCGA Cosmic
rs1478178270	p.Asn329Ser	missense variant	-	NC_000020.11:g.38728047A>G	gnomAD
rs749710984	p.Gln331Arg	missense variant	-	NC_000020.11:g.38728053A>G	ExAC,TOPMed,gnomAD
rs1209081845	p.Gln332His	missense variant	-	NC_000020.11:g.38728057G>T	TOPMed
rs771604217	p.Pro333Arg	missense variant	-	NC_000020.11:g.38728059C>G	ExAC,gnomAD
rs1321074947	p.Ser334Gly	missense variant	-	NC_000020.11:g.38728061A>G	gnomAD
rs373705070	p.Ser334Arg	missense variant	-	NC_000020.11:g.38728063C>A	ESP,ExAC,TOPMed,gnomAD
rs1262212586	p.Glu335Asp	missense variant	-	NC_000020.11:g.38728066G>C	TOPMed
rs986326477	p.His337Gln	missense variant	-	NC_000020.11:g.38728072C>G	TOPMed
rs1299349375	p.His337Arg	missense variant	-	NC_000020.11:g.38728071A>G	gnomAD
rs1308668818	p.Cys338Arg	missense variant	-	NC_000020.11:g.38728073T>C	TOPMed
rs1387598404	p.Met339Ile	missense variant	-	NC_000020.11:g.38728078G>A	TOPMed,gnomAD
rs143923592	p.Met339Val	missense variant	-	NC_000020.11:g.38728076A>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1234326457	p.Met340Ile	missense variant	-	NC_000020.11:g.38728081G>C	gnomAD
COSM3840987	p.Met340Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728081G>T	NCI-TCGA Cosmic
rs1287969144	p.Asn341Thr	missense variant	-	NC_000020.11:g.38728083A>C	gnomAD
COSM3911289	p.Trp342Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000020.11:g.38728086G>A	NCI-TCGA Cosmic
rs1327456008	p.Thr343Ser	missense variant	-	NC_000020.11:g.38728088A>T	gnomAD
COSM1026696	p.Ala346Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728097G>A	NCI-TCGA Cosmic
rs1442916636	p.Ala347Ser	missense variant	-	NC_000020.11:g.38728100G>T	TOPMed,gnomAD
COSM1411719	p.Cys348Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728104G>A	NCI-TCGA Cosmic
rs776361290	p.Val349Met	missense variant	-	NC_000020.11:g.38728106G>A	NCI-TCGA,NCI-TCGA Cosmic
NCI-TCGA novel	p.Val349Leu	missense variant	-	NC_000020.11:g.38728106G>T	NCI-TCGA
rs776361290	p.Val349Met	missense variant	-	NC_000020.11:g.38728106G>A	ExAC,TOPMed,gnomAD
COSM478134	p.Leu350Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728109C>T	NCI-TCGA Cosmic
rs1268911410	p.Leu353Phe	missense variant	-	NC_000020.11:g.38728118C>T	gnomAD
rs773229110	p.Phe354Ile	missense variant	-	NC_000020.11:g.38728121T>A	ExAC,gnomAD
COSM4098285	p.Ala355Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728124G>A	NCI-TCGA Cosmic
rs1156361004	p.Val357Ala	missense variant	-	NC_000020.11:g.38728131T>C	TOPMed
rs1417050812	p.Ala363Thr	missense variant	-	NC_000020.11:g.38728148G>A	gnomAD
rs545702481	p.Ala363Asp	missense variant	-	NC_000020.11:g.38728149C>A	1000Genomes
NCI-TCGA novel	p.Asp364Asn	missense variant	-	NC_000020.11:g.38728151G>A	NCI-TCGA
NCI-TCGA novel	p.Thr366Ile	missense variant	-	NC_000020.11:g.38728158C>T	NCI-TCGA
rs767748758	p.Lys367Arg	missense variant	-	NC_000020.11:g.38728161A>G	ExAC,gnomAD
rs1291854374	p.Val369Ile	missense variant	-	NC_000020.11:g.38728166G>A	TOPMed,gnomAD
rs753053346	p.Ile370Val	missense variant	-	NC_000020.11:g.38728169A>G	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Thr371Met	missense variant	-	NC_000020.11:g.38728173C>T	NCI-TCGA
rs777961679	p.Asn373Ser	missense variant	-	NC_000020.11:g.38728179A>G	ExAC,gnomAD
rs1307602980	p.Asn373Tyr	missense variant	-	NC_000020.11:g.38728178A>T	gnomAD
NCI-TCGA novel	p.Gly376Cys	missense variant	-	NC_000020.11:g.38728187G>T	NCI-TCGA
NCI-TCGA novel	p.Gly376Val	missense variant	-	NC_000020.11:g.38728188G>T	NCI-TCGA
rs367818897	p.Gly376Ser	missense variant	-	NC_000020.11:g.38728187G>A	ESP,ExAC,TOPMed,gnomAD
rs367818897	p.Gly376Arg	missense variant	-	NC_000020.11:g.38728187G>C	ESP,ExAC,TOPMed,gnomAD
rs1243333593	p.Phe385Leu	missense variant	-	NC_000020.11:g.38728214T>C	gnomAD
NCI-TCGA novel	p.Leu386Pro	missense variant	-	NC_000020.11:g.38728218T>C	NCI-TCGA
rs1267757229	p.Val387Met	missense variant	-	NC_000020.11:g.38728220G>A	NCI-TCGA
rs1267757229	p.Val387Met	missense variant	-	NC_000020.11:g.38728220G>A	gnomAD
rs746521205	p.Ala388Thr	missense variant	-	NC_000020.11:g.38728223G>A	ExAC,gnomAD
rs1463733726	p.Lys389Arg	missense variant	-	NC_000020.11:g.38728227A>G	gnomAD
COSM1307371	p.Ser393Tyr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728239C>A	NCI-TCGA Cosmic
rs772822378	p.Ala400Ser	missense variant	-	NC_000020.11:g.38728259G>T	ExAC,gnomAD
rs772822378	p.Ala400Ser	missense variant	-	NC_000020.11:g.38728259G>T	NCI-TCGA,NCI-TCGA Cosmic
COSM1026698	p.Ala400Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728259G>A	NCI-TCGA Cosmic
COSM4438956	p.Ala401Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728262G>A	NCI-TCGA Cosmic
rs763040176	p.Val402Ala	missense variant	-	NC_000020.11:g.38728266T>C	ExAC,gnomAD
rs1168086793	p.Val404Met	missense variant	-	NC_000020.11:g.38728271G>A	gnomAD
rs774612352	p.Leu405Arg	missense variant	-	NC_000020.11:g.38728275T>G	ExAC,gnomAD
NCI-TCGA novel	p.Lys407Arg	missense variant	-	NC_000020.11:g.38728281A>G	NCI-TCGA
rs767447129	p.Leu409Phe	missense variant	-	NC_000020.11:g.38728286C>T	ExAC,gnomAD
rs760744084	p.Phe410Leu	missense variant	-	NC_000020.11:g.38728291C>G	ExAC,gnomAD
rs752996684	p.Phe410Ser	missense variant	-	NC_000020.11:g.38728290T>C	ExAC,gnomAD
rs1322884888	p.Glu412Val	missense variant	-	NC_000020.11:g.38728296A>T	gnomAD
rs982792875	p.Gly413Asp	missense variant	-	NC_000020.11:g.38728299G>A	TOPMed,gnomAD
rs764534852	p.Ser414Arg	missense variant	-	NC_000020.11:g.38728303C>A	ExAC,gnomAD
rs1271934415	p.Ser414Asn	missense variant	-	NC_000020.11:g.38728302G>A	gnomAD
rs1255064268	p.Arg415His	missense variant	-	NC_000020.11:g.38728305G>A	TOPMed,gnomAD
rs1255064268	p.Arg415Leu	missense variant	-	NC_000020.11:g.38728305G>T	TOPMed,gnomAD
rs754192010	p.Arg415Ser	missense variant	-	NC_000020.11:g.38728304C>A	ExAC,gnomAD
rs142909531	p.Ala416Thr	missense variant	-	NC_000020.11:g.38728307G>A	NCI-TCGA,NCI-TCGA Cosmic
rs142909531	p.Ala416Thr	missense variant	-	NC_000020.11:g.38728307G>A	ESP,ExAC,gnomAD
rs142909531	p.Ala416Pro	missense variant	-	NC_000020.11:g.38728307G>C	ESP,ExAC,gnomAD
rs541773581	p.Phe417Leu	missense variant	-	NC_000020.11:g.38728310T>C	1000Genomes,ExAC,gnomAD
rs750876338	p.Phe418Ser	missense variant	-	NC_000020.11:g.38728314T>C	ExAC,TOPMed,gnomAD
rs1296883817	p.Tyr422His	missense variant	-	NC_000020.11:g.38728325T>C	TOPMed
rs34517228	p.Ser423Gly	missense variant	-	NC_000020.11:g.38728328A>G	UniProt,dbSNP
VAR_048121	p.Ser423Gly	missense variant	-	NC_000020.11:g.38728328A>G	UniProt
rs34517228	p.Ser423Gly	missense variant	-	NC_000020.11:g.38728328A>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1358826567	p.Gly424Ser	missense variant	-	NC_000020.11:g.38728331G>A	gnomAD
NCI-TCGA novel	p.Asp425Val	missense variant	-	NC_000020.11:g.38728335A>T	NCI-TCGA
rs1464822213	p.Asp425Asn	missense variant	-	NC_000020.11:g.38728334G>A	gnomAD
rs749092130	p.Asp425Glu	missense variant	-	NC_000020.11:g.38728336C>G	ExAC,TOPMed,gnomAD
rs771050013	p.Gly426Arg	missense variant	-	NC_000020.11:g.38728337G>C	ExAC,TOPMed,gnomAD
rs771050013	p.Gly426Arg	missense variant	-	NC_000020.11:g.38728337G>A	ExAC,TOPMed,gnomAD
rs771050013	p.Gly426Trp	missense variant	-	NC_000020.11:g.38728337G>T	ExAC,TOPMed,gnomAD
COSM6093126	p.Gly426Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728338G>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Arg427Cys	missense variant	-	NC_000020.11:g.38728340C>T	NCI-TCGA
rs778245804	p.Arg427Leu	missense variant	-	NC_000020.11:g.38728341G>T	ExAC,TOPMed,gnomAD
rs778245804	p.Arg427His	missense variant	-	NC_000020.11:g.38728341G>A	ExAC,TOPMed,gnomAD
rs1260681460	p.Lys429Arg	missense variant	-	NC_000020.11:g.38728347A>G	TOPMed
rs371563763	p.Ser430Tyr	missense variant	-	NC_000020.11:g.38728350C>A	ESP,ExAC,gnomAD
rs1366671591	p.Trp431Leu	missense variant	-	NC_000020.11:g.38728353G>T	gnomAD
rs1249221165	p.Trp431Cys	missense variant	-	NC_000020.11:g.38728354G>C	gnomAD
COSM2149784	p.Trp431Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000020.11:g.38728354G>A	NCI-TCGA Cosmic
rs1366671591	p.Trp431Leu	missense variant	-	NC_000020.11:g.38728353G>T	NCI-TCGA
COSM5335074	p.Thr434Met	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728362C>T	NCI-TCGA Cosmic
COSM1411723	p.Arg436His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728368G>A	NCI-TCGA Cosmic
rs1256431418	p.Ala438Thr	missense variant	-	NC_000020.11:g.38728373G>A	gnomAD
rs1256431418	p.Ala438Thr	missense variant	-	NC_000020.11:g.38728373G>A	NCI-TCGA
COSM3290834	p.Ala438Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728374C>T	NCI-TCGA Cosmic
NCI-TCGA novel	p.Val440Ala	missense variant	-	NC_000020.11:g.38728380T>C	NCI-TCGA
rs764187908	p.Val440Ile	missense variant	-	NC_000020.11:g.38728379G>A	ExAC,gnomAD
rs777043497	p.Val441Phe	missense variant	-	NC_000020.11:g.38728382G>T	ExAC,TOPMed,gnomAD
rs777043497	p.Val441Ile	missense variant	-	NC_000020.11:g.38728382G>A	NCI-TCGA
rs777043497	p.Val441Ile	missense variant	-	NC_000020.11:g.38728382G>A	ExAC,TOPMed,gnomAD
rs892354307	p.Thr443Met	missense variant	-	NC_000020.11:g.38728389C>T	NCI-TCGA Cosmic
rs892354307	p.Thr443Met	missense variant	-	NC_000020.11:g.38728389C>T	TOPMed,gnomAD
rs1424686994	p.Leu444Gln	missense variant	-	NC_000020.11:g.38728392T>A	gnomAD
rs1276643179	p.Leu445Phe	missense variant	-	NC_000020.11:g.38728394C>T	TOPMed
COSM4098290	p.Leu445Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728395T>G	NCI-TCGA Cosmic
COSM3693487	p.Ala447Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728400G>A	NCI-TCGA Cosmic
rs1332984368	p.Val450Ala	missense variant	-	NC_000020.11:g.38728410T>C	TOPMed
NCI-TCGA novel	p.Pro451Thr	missense variant	-	NC_000020.11:g.38728412C>A	NCI-TCGA
NCI-TCGA novel	p.Ala454Thr	missense variant	-	NC_000020.11:g.38728421G>A	NCI-TCGA
rs767106874	p.Leu456Phe	missense variant	-	NC_000020.11:g.38728427C>T	ExAC,gnomAD
rs1220661138	p.Leu459Phe	missense variant	-	NC_000020.11:g.38728436C>T	gnomAD
NCI-TCGA novel	p.Gly461Ser	missense variant	-	NC_000020.11:g.38728442G>A	NCI-TCGA
rs1487549655	p.Leu475Phe	missense variant	-	NC_000020.11:g.38728484C>T	gnomAD
COSM6159763	p.Phe476Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728488T>C	NCI-TCGA Cosmic
rs1193079299	p.Arg479Cys	missense variant	-	NC_000020.11:g.38728496C>T	gnomAD
rs1430273913	p.Arg479Leu	missense variant	-	NC_000020.11:g.38728497G>T	gnomAD
rs1460374393	p.Leu481Pro	missense variant	-	NC_000020.11:g.38728503T>C	gnomAD
rs1414811807	p.Arg483His	missense variant	-	NC_000020.11:g.38728509G>A	NCI-TCGA Cosmic
rs1414811807	p.Arg483His	missense variant	-	NC_000020.11:g.38728509G>A	gnomAD
rs547270146	p.Arg483Cys	missense variant	-	NC_000020.11:g.38728508C>T	ExAC,TOPMed,gnomAD
rs1473110302	p.Lys484Asn	missense variant	-	NC_000020.11:g.38728513G>T	TOPMed
rs1473110302	p.Lys484Asn	missense variant	-	NC_000020.11:g.38728513G>T	NCI-TCGA Cosmic
COSM3799524	p.Leu485Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728514C>G	NCI-TCGA Cosmic
rs757122447	p.Gln489Glu	missense variant	-	NC_000020.11:g.38728526C>G	ExAC,gnomAD
rs1347540748	p.Gln489Arg	missense variant	-	NC_000020.11:g.38728527A>G	gnomAD
COSM4098292	p.Val494Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728541G>A	NCI-TCGA Cosmic
rs745821668	p.Ala495Val	missense variant	-	NC_000020.11:g.38728545C>T	ExAC,gnomAD
rs778809530	p.Ala495Thr	missense variant	-	NC_000020.11:g.38728544G>A	ExAC,gnomAD
rs778809530	p.Ala495Thr	missense variant	-	NC_000020.11:g.38728544G>A	NCI-TCGA,NCI-TCGA Cosmic
NCI-TCGA novel	p.Ile496Val	missense variant	-	NC_000020.11:g.38728547A>G	NCI-TCGA
rs1407730184	p.Phe497Val	missense variant	-	NC_000020.11:g.38728550T>G	gnomAD
NCI-TCGA novel	p.Val498Ile	missense variant	-	NC_000020.11:g.38728553G>A	NCI-TCGA
COSM4098293	p.Gly500Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728559G>A	NCI-TCGA Cosmic
rs1290034766	p.Gly501Ser	missense variant	-	NC_000020.11:g.38728562G>A	gnomAD
rs1329760124	p.Ile502Met	missense variant	-	NC_000020.11:g.38728567C>G	NCI-TCGA
rs1329760124	p.Ile502Met	missense variant	-	NC_000020.11:g.38728567C>G	gnomAD
rs372989549	p.Val505Leu	missense variant	-	NC_000020.11:g.38728574G>T	ESP,ExAC,TOPMed,gnomAD
rs1319953535	p.Val509Met	missense variant	-	NC_000020.11:g.38728586G>A	TOPMed,gnomAD
rs1457450615	p.His510Tyr	missense variant	-	NC_000020.11:g.38728589C>T	TOPMed
rs1269835399	p.Leu512Phe	missense variant	-	NC_000020.11:g.38728595C>T	gnomAD
NCI-TCGA novel	p.Glu513Lys	missense variant	-	NC_000020.11:g.38728598G>A	NCI-TCGA
NCI-TCGA novel	p.Glu513Asp	missense variant	-	NC_000020.11:g.38728600G>T	NCI-TCGA
rs747052666	p.Gly514Ser	missense variant	-	NC_000020.11:g.38728601G>A	ExAC,gnomAD
NCI-TCGA novel	p.Leu515Pro	missense variant	-	NC_000020.11:g.38728605T>C	NCI-TCGA
rs1254504463	p.Leu515Phe	missense variant	-	NC_000020.11:g.38728604C>T	gnomAD
rs776847257	p.Ile516Met	missense variant	-	NC_000020.11:g.38728609C>G	ExAC,gnomAD
rs776847257	p.Ile516Met	missense variant	-	NC_000020.11:g.38728609C>G	NCI-TCGA
rs546892153	p.Ile516Val	missense variant	-	NC_000020.11:g.38728607A>G	1000Genomes,ExAC,TOPMed,gnomAD
rs1406556808	p.Tyr519His	missense variant	-	NC_000020.11:g.38728616T>C	TOPMed,gnomAD
COSM3290846	p.Arg520Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728620G>A	NCI-TCGA Cosmic
rs140172143	p.Thr521Asn	missense variant	-	NC_000020.11:g.38728623C>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1350821917	p.Asn522Lys	missense variant	-	NC_000020.11:g.38728627C>A	TOPMed,gnomAD
rs773546573	p.Asn522Ile	missense variant	-	NC_000020.11:g.38728626A>T	ExAC,gnomAD
rs940895631	p.Ala523Thr	missense variant	-	NC_000020.11:g.38728628G>A	TOPMed,gnomAD
COSM3693488	p.Ala523Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000020.11:g.38728629C>T	NCI-TCGA Cosmic
rs1461347701	p.Glu524Gly	missense variant	-	NC_000020.11:g.38728632A>G	TOPMed,gnomAD

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0002395	Alzheimer's Disease	disease	BEFREE
C0008925	Cleft Palate	disease	BEFREE
C0014544	Epilepsy	disease	BEFREE
C0019322	Umbilical hernia	phenotype	BEFREE
C0036341	Schizophrenia	disease	BEFREE;LHGDN;PSYGENET
C1306503	Congenital exomphalos	disease	BEFREE
C1837218	Cleft palate, isolated	disease	BEFREE
C2981150	Uranostaphyloschisis	disease	BEFREE

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0015171	amino acid transmembrane transporter activity	IBA
GO:0015171	amino acid transmembrane transporter activity	TAS
GO:0015187	glycine transmembrane transporter activity	IEA
GO:0015495	gamma-aminobutyric acid:proton symporter activity	IBA
GO:0015495	gamma-aminobutyric acid:proton symporter activity	TAS

GO:Biological Process

GO ID	GO Term	Evidence
GO:0003333	amino acid transmembrane transport	IBA
GO:0006811	ion transport	TAS
GO:0007269	neurotransmitter secretion	TAS
GO:0007568	aging	IEA
GO:0015812	gamma-aminobutyric acid transport	IEA
GO:0015816	glycine transport	IEA
GO:0021766	hippocampus development	IEA
GO:0098700	neurotransmitter loading into synaptic vesicle	IBA

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0005886	plasma membrane	TAS
GO:0030285	integral component of synaptic vesicle membrane	IBA
GO:0030425	dendrite	IDA
GO:0030672	synaptic vesicle membrane	TAS
GO:0043005	neuron projection	IDA
GO:0044292	dendrite terminus	IBA
GO:0044306	neuron projection terminus	IDA
GO:0044306	neuron projection terminus	IBA
GO:0044316	cone cell pedicle	IEA
GO:0048786	presynaptic active zone	IEA
GO:0051286	cell tip	IEA
GO:0060077	inhibitory synapse	IEA
GO:0061202	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane	TAS
GO:0098982	GABA-ergic synapse	IEA

Reactome Pathway

Reactome ID	Reactome Term	Evidence
R-HSA-112310	Neurotransmitter release cycle	TAS
R-HSA-112315	Transmission across Chemical Synapses	TAS
R-HSA-112316	Neuronal System	TAS
R-HSA-382551	Transport of small molecules	TAS
R-HSA-425393	Transport of inorganic cations/anions and amino acids/oligopeptides	TAS
R-HSA-425407	SLC-mediated transmembrane transport	TAS
R-HSA-888590	GABA synthesis, release, reuptake and degradation	TAS

Drugs and compounds information

ID	Drug Name	Action	PubMed
D015655	1-Methyl-4-phenylpyridinium	1-Methyl-4-phenylpyridinium results in increased expression of SLC32A1 mRNA	24810058
C029790	2,2',3',4,4',5-hexachlorobiphenyl	[2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with PCB 180] results in decreased expression of SLC32A1 mRNA	25510870
C511295	2,2',4,4'-tetrabromodiphenyl ether	2,2',4,4'-tetrabromodiphenyl ether results in decreased expression of SLC32A1 mRNA	27291303
C111118	2',3,3',4',5-pentachloro-4-hydroxybiphenyl	2',3,3',4',5-pentachloro-4-hydroxybiphenyl results in decreased expression of SLC32A1 mRNA	19114083
C081766	2,4,4'-trichlorobiphenyl	[2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with PCB 180] results in decreased expression of SLC32A1 mRNA	25510870
C014024	2,4,5,2',4',5'-hexachlorobiphenyl	[2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with PCB 180] results in decreased expression of SLC32A1 mRNA	25510870
C009828	2,4,5,2',5'-pentachlorobiphenyl	[2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with PCB 180] results in decreased expression of SLC32A1 mRNA	25510870
C009407	2,5,2',5'-tetrachlorobiphenyl	[2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with PCB 180] results in decreased expression of SLC32A1 mRNA	25510870
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of SLC32A1 mRNA	27188386
C029753	aflatoxin B2	aflatoxin B2 results in increased methylation of SLC32A1 polyA tail	30157460
D000643	Ammonium Chloride	Ammonium Chloride affects the expression of SLC32A1 mRNA	16483693
D001151	Arsenic	Arsenic affects the methylation of SLC32A1 gene	25304211
C015001	arsenite	arsenite results in increased methylation of SLC32A1 promoter	23974009
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in decreased expression of SLC32A1 mRNA	21839799
C543008	bis(4-hydroxyphenyl)sulfone	bis(4-hydroxyphenyl)sulfone results in decreased expression of SLC32A1 mRNA	30951980
C006780	bisphenol A	bisphenol A results in increased methylation of SLC32A1 promoter	27312807
C006780	bisphenol A	[bisphenol A co-treated with Diethylhexyl Phthalate co-treated with Dibutyl Phthalate] affects the methylation of SLC32A1 promoter	23359474
C006780	bisphenol A	bisphenol A results in decreased expression of SLC32A1 mRNA	25181051
C006780	bisphenol A	bisphenol A results in increased expression of SLC32A1 mRNA	27571134
C013418	bromfenacoum	bromfenacoum results in decreased expression of SLC32A1 protein	28903499
C018475	butyraldehyde	butyraldehyde results in increased expression of SLC32A1 mRNA	26079696
D002251	Carbon Tetrachloride	Carbon Tetrachloride results in decreased expression of SLC32A1 mRNA	16644059
D002794	Choline	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased methylation of SLC32A1 gene	20938992
D015283	Citalopram	Citalopram results in decreased expression of SLC32A1 protein	20707986
D003042	Cocaine	Cocaine results in increased expression of SLC32A1 mRNA	16076954
D003300	Copper	Copper results in increased expression of SLC32A1 mRNA	16629173
D003907	Dexamethasone	Dexamethasone inhibits the reaction [RX3 gene mutant form affects the expression of SLC32A1 mRNA]	27941970
D003993	Dibutyl Phthalate	[bisphenol A co-treated with Diethylhexyl Phthalate co-treated with Dibutyl Phthalate] affects the methylation of SLC32A1 promoter	23359474
D004051	Diethylhexyl Phthalate	[bisphenol A co-treated with Diethylhexyl Phthalate co-treated with Dibutyl Phthalate] affects the methylation of SLC32A1 promoter	23359474
C516138	dorsomorphin	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of SLC32A1 mRNA	27188386
D000431	Ethanol	Ethanol results in increased expression of SLC32A1 mRNA	30319688
D000431	Ethanol	Ethanol results in increased expression of SLC32A1 mRNA	15729141
D004997	Ethinyl Estradiol	Ethinyl Estradiol results in decreased expression of SLC32A1 mRNA	27571134
C540355	fenamidone	fenamidone results in decreased expression of SLC32A1 mRNA	27029645
D005419	Flavonoids	Flavonoids results in increased expression of SLC32A1 mRNA	18035473
D005473	Fluoxetine	Fluoxetine results in decreased expression of SLC32A1 protein	20707986
D005492	Folic Acid	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased methylation of SLC32A1 gene	20938992
C030691	gluconic acid	gluconic acid results in decreased expression of SLC32A1 mRNA	16556975
D007649	Ketamine	Ketamine results in increased expression of SLC32A1 mRNA	20080153
D007854	Lead	Lead affects the expression of SLC32A1 mRNA	28903495
C008261	lead acetate	lead acetate affects the expression of SLC32A1 mRNA	24875535
C008261	lead acetate	lead acetate results in decreased expression of SLC32A1 protein	20375082
D008694	Methamphetamine	Methamphetamine results in decreased expression of SLC32A1 mRNA	29802913
D008715	Methionine	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased methylation of SLC32A1 gene	20938992
D010269	Paraquat	Paraquat results in decreased expression of SLC32A1 protein	24521700
C410127	PCB 180	[2,4,4'-trichlorobiphenyl co-treated with 2,5,2',5'-tetrachlorobiphenyl co-treated with 2,4,5,2',5'-pentachlorobiphenyl co-treated with 2,2',3',4,4',5-hexachlorobiphenyl co-treated with 2,4,5,2',4',5'-hexachlorobiphenyl co-treated with PCB 180] results in decreased expression of SLC32A1 mRNA	25510870
C086401	pentabromodiphenyl ether	pentabromodiphenyl ether results in increased expression of SLC32A1 protein	23916505
D010416	Pentachlorophenol	Pentachlorophenol results in decreased expression of SLC32A1 mRNA	27181905
C046012	pentanal	pentanal results in increased expression of SLC32A1 mRNA	26079696
D010662	Phenylmercuric Acetate	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of SLC32A1 mRNA	27188386
D010862	Pilocarpine	Pilocarpine results in increased expression of SLC32A1 mRNA	17503488
D010862	Pilocarpine	Pilocarpine results in increased expression of SLC32A1 protein	17503488
D011441	Propylthiouracil	Propylthiouracil results in decreased expression of SLC32A1 mRNA	24780913
C009277	sodium arsenate	sodium arsenate results in decreased expression of SLC32A1 mRNA	21795629
C017947	sodium arsenite	sodium arsenite results in increased expression of SLC32A1 mRNA	25879800
D012978	Sodium Oxybate	SLC32A1 protein affects the uptake of Sodium Oxybate	15745703
D014050	Toluene	Toluene affects the expression of SLC32A1 mRNA	21827849
D014212	Tretinoin	Tretinoin results in increased expression of SLC32A1 mRNA	23724009
C012589	trichostatin A	trichostatin A results in increased expression of SLC32A1 mRNA	24935251
D014635	Valproic Acid	Valproic Acid affects the expression of SLC32A1 mRNA	25979313
D014635	Valproic Acid	Valproic Acid results in increased expression of SLC32A1 mRNA	24935251

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0968	Cytoplasmic vesicle
KW-0325	Glycoprotein
KW-0472	Membrane
KW-0532	Neurotransmitter transport
KW-0944	Nitration
KW-0621	Polymorphism
KW-1185	Reference proteome
KW-0812	Transmembrane
KW-1133	Transmembrane helix
KW-0813	Transport

Interpro

InterPro ID	InterPro Term
IPR013057	AA_transpt_TM

PROSITE

PROSITE ID	PROSITE Term

Pfam

Pfam ID	Pfam Term
PF01490	Aa_trans

Gene: SLC32A1

Basic information

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

There is no related protein structure for this gene.

Protein disorder information

Orthologous information

Other genetic variants/mutations

Disease or phenotype associated information

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO:Biological Process

GO:Cellular Component

Reactome Pathway

Drugs and compounds information

Functional annotations

Keywords

Interpro

PROSITE

Pfam

Protein-protein interaction

Protein-miRNA interaction