CleftGeneDB-Search

Gene: BPNT2

Basic information

Tag	Content
Uniprot ID	Q9NX62; Q6NVY7;
Entrez ID	54928
Genbank protein ID	AAK52336.1; BAA91158.1; AAH17797.1; AAH67814.1;
Genbank nucleotide ID	NM_017813.4
Ensembl protein ID	ENSP00000262644
Ensembl nucleotide ID	ENSG00000104331
Gene name	Golgi-resident adenosine 3',5'-bisphosphate 3'-phosphatase
Gene symbol	BPNT2
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type
Developmental stage
Data sources	Homology search
Reference
Functional description	Exhibits 3'-nucleotidase activity toward adenosine 3',5'-bisphosphate (PAP), namely hydrolyzes adenosine 3',5'-bisphosphate into adenosine 5'-monophosphate (AMP) and a phosphate. May play a role in the formation of skeletal elements derived through endochondral ossification, possibly by clearing adenosine 3',5'-bisphosphate produced by Golgi sulfotransferases during glycosaminoglycan sulfation. Has no activity toward 3'-phosphoadenosine 5'-phosphosulfate (PAPS) or inositol phosphate (IP) substrates including I(1)P, I(1,4)P2, I(1,3,4)P3, I(1,4,5)P3 and I(1,3,4,5)P4.
Sequence	MAPMGIRLSP LGVAVFCLLG LGVLYHLYSG FLAGRFSLFG LGGEPGGGAA GPAAAADGGT 60 VDLREMLAVS VLAAVRGGDE VRRVRESNVL HEKSKGKTRE GAEDKMTSGD VLSNRKMFYL 120 LKTAFPSVQI NTEEHVDAAD QEVILWDHKI PEDILKEVTT PKEVPAESVT VWIDPLDATQ 180 EYTEDLRKYV TTMVCVAVNG KPMLGVIHKP FSEYTAWAMV DGGSNVKARS SYNEKTPRIV 240 VSRSHSGMVK QVALQTFGNQ TTIIPAGGAG YKVLALLDVP DKSQEKADLY IHVTYIKKWD 300 ICAGNAILKA LGGHMTTLSG EEISYTGSDG IEGGLLASIR MNHQALVRKL PDLEKTGHK 359

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression information

Gene expression in different tissues (GTEx V7)

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

There is no related protein structure for this gene.

Protein disorder information

Orthologous information

Relation	Gene symbol	Entrez ID	UniProt ID	Cleft type	Species	Evidence	Details
1:1 ortholog	BPNT2	532797	Q2KJ53		Bos taurus	Prediction	More>>
1:1 ortholog	BPNT2	477890	E2RMJ7		Canis lupus familiaris	Prediction	More>>
1:1 ortholog	IMPAD1		A0A452ECA6		Capra hircus	Prediction	More>>
1:1 ortholog	BPNT2	54928	Q9NX62		Homo sapiens	Prediction	More>>
1:1 ortholog	Bpnt2	242291	Q80V26	CPO	Mus musculus	Publication	More>>
1:1 ortholog	BPNT2	100156925	F1RT67		Sus scrofa	Prediction	More>>
1:1 ortholog	IMPAD1	100343037	G1SLS8		Oryctolagus cuniculus	Prediction	More>>
1:1 ortholog	bpnt2	641570	Q2YDR3		Danio rerio	Prediction	More>>

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
rs1445242968	p.Pro3Leu	missense variant	-	NC_000008.11:g.56993578G>A	TOPMed,gnomAD
rs752883986	p.Met4Leu	missense variant	-	NC_000008.11:g.56993576T>A	ExAC,gnomAD
rs752883986	p.Met4Val	missense variant	-	NC_000008.11:g.56993576T>C	ExAC,gnomAD
rs904296684	p.Gly12Val	missense variant	-	NC_000008.11:g.56993551C>A	TOPMed,gnomAD
rs778891336	p.Gly12Arg	missense variant	-	NC_000008.11:g.56993552C>G	TOPMed
NCI-TCGA novel	p.Ala14Thr	missense variant	-	NC_000008.11:g.56993546C>T	NCI-TCGA
rs767591752	p.Val15Leu	missense variant	-	NC_000008.11:g.56993543C>G	ExAC,TOPMed,gnomAD
rs767591752	p.Val15Met	missense variant	-	NC_000008.11:g.56993543C>T	ExAC,TOPMed,gnomAD
rs1286047293	p.Cys17Ser	missense variant	-	NC_000008.11:g.56993536C>G	TOPMed
rs759502337	p.Cys17Gly	missense variant	-	NC_000008.11:g.56993537A>C	ExAC,TOPMed,gnomAD
rs1228813543	p.Gly22Ser	missense variant	-	NC_000008.11:g.56993522C>T	TOPMed
rs1316564092	p.Val23Leu	missense variant	-	NC_000008.11:g.56993519C>G	gnomAD
rs761908415	p.Ala33Asp	missense variant	-	NC_000008.11:g.56993488G>T	ExAC,gnomAD
rs765253964	p.Ala33Ser	missense variant	-	NC_000008.11:g.56993489C>A	ExAC,gnomAD
rs1367501011	p.Gly34Arg	missense variant	-	NC_000008.11:g.56993486C>G	gnomAD
rs776502522	p.Phe39Cys	missense variant	-	NC_000008.11:g.56993470A>C	ExAC,gnomAD
rs1184270689	p.Gly40Arg	missense variant	-	NC_000008.11:g.56993468C>G	gnomAD
rs1223820299	p.Gly42Ser	missense variant	-	NC_000008.11:g.56993462C>T	gnomAD
rs754849895	p.Gly43Ser	missense variant	-	NC_000008.11:g.56993459C>T	TOPMed,gnomAD
rs754849895	p.Gly43Cys	missense variant	-	NC_000008.11:g.56993459C>A	TOPMed,gnomAD
rs1160676872	p.Gly46Ser	missense variant	-	NC_000008.11:g.56993450C>T	TOPMed
rs1160676872	p.Gly46Arg	missense variant	-	NC_000008.11:g.56993450C>G	TOPMed
rs1279700049	p.Ala50Val	missense variant	-	NC_000008.11:g.56993437G>A	TOPMed,gnomAD
rs1166093463	p.Gly51Arg	missense variant	-	NC_000008.11:g.56993435C>G	TOPMed
rs775038970	p.Gly51Glu	missense variant	-	NC_000008.11:g.56993434C>T	ExAC,TOPMed,gnomAD
rs1442414390	p.Pro52Leu	missense variant	-	NC_000008.11:g.56993431G>A	TOPMed
rs745353531	p.Pro52Ser	missense variant	-	NC_000008.11:g.56993432G>A	ExAC,TOPMed,gnomAD
rs745353531	p.Pro52Ala	missense variant	-	NC_000008.11:g.56993432G>C	ExAC,TOPMed,gnomAD
rs1353982271	p.Ala53Val	missense variant	-	NC_000008.11:g.56993428G>A	TOPMed
rs1347387981	p.Ala53Thr	missense variant	-	NC_000008.11:g.56993429C>T	gnomAD
rs1385770174	p.Ala54Val	missense variant	-	NC_000008.11:g.56993425G>A	gnomAD
rs757690431	p.Ala54Thr	missense variant	-	NC_000008.11:g.56993426C>T	ExAC,gnomAD
rs749806114	p.Ala55Gly	missense variant	-	NC_000008.11:g.56993422G>C	ExAC,TOPMed,gnomAD
rs749806114	p.Ala55Val	missense variant	-	NC_000008.11:g.56993422G>A	ExAC,TOPMed,gnomAD
rs1361729558	p.Asp57Tyr	missense variant	-	NC_000008.11:g.56993417C>A	TOPMed
COSM3779291	p.Asp57Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.56993417C>T	NCI-TCGA Cosmic
rs560769519	p.Gly58Arg	missense variant	-	NC_000008.11:g.56993414C>G	1000Genomes,ExAC,gnomAD
rs756466129	p.Gly59Cys	missense variant	-	NC_000008.11:g.56993411C>A	ExAC,gnomAD
rs147738902	p.Gly59Asp	missense variant	-	NC_000008.11:g.56993410C>T	ESP,ExAC,TOPMed,gnomAD
rs767610613	p.Thr60Ile	missense variant	-	NC_000008.11:g.56993407G>A	ExAC,TOPMed,gnomAD
rs751687995	p.Leu63Phe	missense variant	-	NC_000008.11:g.56993397C>G	ExAC,gnomAD
rs776735539	p.Arg64Leu	missense variant	-	NC_000008.11:g.56993395C>A	ExAC,gnomAD
rs761785565	p.Arg64Gly	missense variant	-	NC_000008.11:g.56993396G>C	ExAC,TOPMed,gnomAD
rs761785565	p.Arg64Ser	missense variant	-	NC_000008.11:g.56993396G>T	ExAC,TOPMed,gnomAD
COSM3413074	p.Arg64Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.56993396G>A	NCI-TCGA Cosmic
rs763945623	p.Glu65Gln	missense variant	-	NC_000008.11:g.56993393C>G	ExAC,gnomAD
NCI-TCGA novel	p.Glu65Lys	missense variant	-	NC_000008.11:g.56993393C>T	NCI-TCGA
rs1472661970	p.Met66Thr	missense variant	-	NC_000008.11:g.56993389A>G	TOPMed
rs1347178892	p.Met66Ile	missense variant	-	NC_000008.11:g.56993388C>G	TOPMed,gnomAD
rs1252434473	p.Ala68Val	missense variant	-	NC_000008.11:g.56993383G>A	gnomAD
rs1435713372	p.Val69Met	missense variant	-	NC_000008.11:g.56993381C>T	gnomAD
rs775406965	p.Ser70Leu	missense variant	-	NC_000008.11:g.56993377G>A	ExAC,gnomAD
rs745537127	p.Val71Leu	missense variant	-	NC_000008.11:g.56993375C>A	ExAC,TOPMed,gnomAD
rs745537127	p.Val71Met	missense variant	-	NC_000008.11:g.56993375C>T	ExAC,TOPMed,gnomAD
rs1177587665	p.Ala73Val	missense variant	-	NC_000008.11:g.56993368G>A	gnomAD
rs770447365	p.Ala73Thr	missense variant	-	NC_000008.11:g.56993369C>T	ExAC,gnomAD
rs546867419	p.Ala74Thr	missense variant	-	NC_000008.11:g.56993366C>T	1000Genomes,gnomAD
rs1280894970	p.Val75Ala	missense variant	-	NC_000008.11:g.56993362A>G	TOPMed,gnomAD
rs1280894970	p.Val75Asp	missense variant	-	NC_000008.11:g.56993362A>T	TOPMed,gnomAD
rs983473550	p.Val75Ile	missense variant	-	NC_000008.11:g.56993363C>T	TOPMed
rs1338531504	p.Gly77Arg	missense variant	-	NC_000008.11:g.56993357C>G	TOPMed
rs756692741	p.Asp79Gly	missense variant	-	NC_000008.11:g.56993350T>C	ExAC,TOPMed,gnomAD
rs756692741	p.Asp79Ala	missense variant	-	NC_000008.11:g.56993350T>G	ExAC,TOPMed,gnomAD
rs1423540835	p.Asp79Tyr	missense variant	-	NC_000008.11:g.56993351C>A	gnomAD
rs1345897724	p.Glu80Asp	missense variant	-	NC_000008.11:g.56993346C>G	gnomAD
rs189210871	p.Val81Gly	missense variant	-	NC_000008.11:g.56993344A>C	1000Genomes
rs748449103	p.Val81Met	missense variant	-	NC_000008.11:g.56993345C>T	ExAC,gnomAD
rs751845541	p.Arg85His	missense variant	-	NC_000008.11:g.56993332C>T	ExAC,TOPMed,gnomAD
rs371716301	p.Arg85Cys	missense variant	-	NC_000008.11:g.56993333G>A	ESP,ExAC,TOPMed,gnomAD
rs780236254	p.Asn88Ser	missense variant	-	NC_000008.11:g.56993323T>C	ExAC,TOPMed,gnomAD
rs750573329	p.Leu90Phe	missense variant	-	NC_000008.11:g.56993318G>A	ExAC,gnomAD
rs763919379	p.Glu92Asp	missense variant	-	NC_000008.11:g.56993310C>A	NCI-TCGA
rs763919379	p.Glu92Asp	missense variant	-	NC_000008.11:g.56993310C>A	ExAC,gnomAD
rs368994525	p.Ser94Phe	missense variant	-	NC_000008.11:g.56993305G>A	ESP,ExAC,gnomAD
rs368994525	p.Ser94Cys	missense variant	-	NC_000008.11:g.56993305G>C	ESP,ExAC,gnomAD
rs1340139892	p.Lys95Glu	missense variant	-	NC_000008.11:g.56993303T>C	NCI-TCGA
rs1340139892	p.Lys95Glu	missense variant	-	NC_000008.11:g.56993303T>C	TOPMed
rs1364550220	p.Gly96Glu	missense variant	-	NC_000008.11:g.56993299C>T	gnomAD
rs1364550220	p.Gly96Val	missense variant	-	NC_000008.11:g.56993299C>A	gnomAD
rs767354346	p.Lys97Arg	missense variant	-	NC_000008.11:g.56993296T>C	ExAC,TOPMed,gnomAD
rs759136888	p.Thr98Ser	missense variant	-	NC_000008.11:g.56993294T>A	ExAC,gnomAD
rs1411012084	p.Arg99Ser	missense variant	-	NC_000008.11:g.56993291G>T	gnomAD
rs1395636982	p.Arg99Leu	missense variant	-	NC_000008.11:g.56993290C>A	TOPMed,gnomAD
rs367837388	p.Glu100Gln	missense variant	-	NC_000008.11:g.56993288C>G	ESP
rs1167277457	p.Glu100Asp	missense variant	-	NC_000008.11:g.56993286C>A	gnomAD
rs112318196	p.Ala102Val	missense variant	-	NC_000008.11:g.56993281G>A	ESP,ExAC,TOPMed,gnomAD
rs1298702411	p.Ala102Pro	missense variant	-	NC_000008.11:g.56993282C>G	gnomAD
rs1183771091	p.Glu103Lys	missense variant	-	NC_000008.11:g.56993279C>T	TOPMed,gnomAD
rs1183771091	p.Glu103Ter	stop gained	-	NC_000008.11:g.56993279C>A	TOPMed,gnomAD
rs772766265	p.Asp104Asn	missense variant	-	NC_000008.11:g.56993276C>T	ExAC,gnomAD
rs559655615	p.Asp104Gly	missense variant	-	NC_000008.11:g.56993275T>C	ExAC,TOPMed,gnomAD
rs1209248902	p.Lys105Glu	missense variant	-	NC_000008.11:g.56993273T>C	gnomAD
NCI-TCGA novel	p.Met106Leu	missense variant	-	NC_000008.11:g.56993270T>G	NCI-TCGA
RCV000149814	p.Ser108Ter	frameshift	Chondrodysplasia with joint dislocations, GPAPP type	NC_000008.11:g.56993262del	ClinVar
rs748695366	p.Ser108Asn	missense variant	-	NC_000008.11:g.56993263C>T	ExAC,gnomAD
rs748695366	p.Ser108Thr	missense variant	-	NC_000008.11:g.56993263C>G	ExAC,gnomAD
rs374711732	p.Asp110His	missense variant	-	NC_000008.11:g.56993258C>G	ESP,TOPMed,gnomAD
rs374711732	p.Asp110Asn	missense variant	-	NC_000008.11:g.56993258C>T	ESP,TOPMed,gnomAD
rs769088343	p.Val111Met	missense variant	-	NC_000008.11:g.56993255C>T	ExAC,gnomAD
rs769088343	p.Val111Leu	missense variant	-	NC_000008.11:g.56993255C>A	ExAC,gnomAD
COSM4856411	p.Ser113Ala	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.56993249A>C	NCI-TCGA Cosmic
rs1175973958	p.Arg115Cys	missense variant	-	NC_000008.11:g.56993243G>A	NCI-TCGA
rs1306674316	p.Arg115Leu	missense variant	-	NC_000008.11:g.56993242C>A	TOPMed,gnomAD
rs1175973958	p.Arg115Cys	missense variant	-	NC_000008.11:g.56993243G>A	gnomAD
rs145484021	p.Lys116Arg	missense variant	-	NC_000008.11:g.56993239T>C	ESP,TOPMed,gnomAD
rs945747430	p.Lys116Asn	missense variant	-	NC_000008.11:g.56993238C>G	TOPMed
rs758745200	p.Met117Ile	missense variant	-	NC_000008.11:g.56993235C>T	ExAC,gnomAD
RCV000343279	p.Tyr119His	missense variant	Chondrodysplasia	NC_000008.11:g.56993231A>G	ClinVar
rs750520263	p.Tyr119Cys	missense variant	-	NC_000008.11:g.56993230T>C	ExAC,TOPMed,gnomAD
rs886063020	p.Tyr119His	missense variant	-	NC_000008.11:g.56993231A>G	-
rs750520263	p.Tyr119Phe	missense variant	-	NC_000008.11:g.56993230T>A	ExAC,TOPMed,gnomAD
rs750520263	p.Tyr119Phe	missense variant	-	NC_000008.11:g.56993230T>A	NCI-TCGA
NCI-TCGA novel	p.Leu120Pro	missense variant	-	NC_000008.11:g.56993227A>G	NCI-TCGA
rs752698460	p.Lys122Asn	missense variant	-	NC_000008.11:g.56993220C>G	ExAC,gnomAD
rs752698460	p.Lys122Asn	missense variant	-	NC_000008.11:g.56993220C>A	ExAC,gnomAD
rs767173166	p.Ala124Ser	missense variant	-	NC_000008.11:g.56993216C>A	ExAC,gnomAD
rs1202905686	p.Pro126Arg	missense variant	-	NC_000008.11:g.56993209G>C	TOPMed,gnomAD
rs1202905686	p.Pro126Leu	missense variant	-	NC_000008.11:g.56993209G>A	TOPMed,gnomAD
NCI-TCGA novel	p.Pro126Thr	missense variant	-	NC_000008.11:g.56993210G>T	NCI-TCGA
rs1229746286	p.Ser127Arg	missense variant	-	NC_000008.11:g.56993207T>G	TOPMed
rs759294651	p.Val128Phe	missense variant	-	NC_000008.11:g.56993204C>A	ExAC,TOPMed,gnomAD
rs1202615244	p.Ile130Ser	missense variant	-	NC_000008.11:g.56980196A>C	gnomAD
COSM4915529	p.Ile130Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.56980197T>C	NCI-TCGA Cosmic
rs1429774253	p.Thr132Ala	missense variant	-	NC_000008.11:g.56980191T>C	gnomAD
rs1323863706	p.His135Tyr	missense variant	-	NC_000008.11:g.56980182G>A	gnomAD
rs757988742	p.Val136Ala	missense variant	-	NC_000008.11:g.56980178A>G	ExAC,gnomAD
rs766168164	p.Val136Leu	missense variant	-	NC_000008.11:g.56980179C>A	ExAC,TOPMed,gnomAD
rs766168164	p.Val136Met	missense variant	-	NC_000008.11:g.56980179C>T	ExAC,TOPMed,gnomAD
rs764614713	p.Ala138Val	missense variant	-	NC_000008.11:g.56980172G>A	ExAC,gnomAD
rs375488265	p.Ala138Thr	missense variant	-	NC_000008.11:g.56980173C>T	ESP,ExAC,TOPMed,gnomAD
rs761357561	p.Ala139Gly	missense variant	-	NC_000008.11:g.56980169G>C	ExAC,TOPMed,gnomAD
rs761357561	p.Ala139Asp	missense variant	-	NC_000008.11:g.56980169G>T	ExAC,TOPMed,gnomAD
rs1462017672	p.Ala139Pro	missense variant	-	NC_000008.11:g.56980170C>G	gnomAD
NCI-TCGA novel	p.Asp140Asn	missense variant	-	NC_000008.11:g.56980167C>T	NCI-TCGA
rs923337791	p.Gln141His	missense variant	-	NC_000008.11:g.56980162C>A	TOPMed,gnomAD
rs1312183920	p.Glu142Lys	missense variant	-	NC_000008.11:g.56980161C>T	gnomAD
rs764689405	p.Trp146Leu	missense variant	-	NC_000008.11:g.56980148C>A	ExAC,TOPMed,gnomAD
rs761335643	p.Asp147Asn	missense variant	-	NC_000008.11:g.56980146C>T	ExAC,gnomAD
rs1318074167	p.Asp147Gly	missense variant	-	NC_000008.11:g.56980145T>C	gnomAD
rs148440829	p.Lys149Glu	missense variant	-	NC_000008.11:g.56980140T>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Pro151Ser	missense variant	-	NC_000008.11:g.56980134G>A	NCI-TCGA
rs964832400	p.Asp153Ala	missense variant	-	NC_000008.11:g.56980127T>G	TOPMed,gnomAD
NCI-TCGA novel	p.Asp153Asn	missense variant	-	NC_000008.11:g.56980128C>T	NCI-TCGA
rs774598791	p.Glu157Gln	missense variant	-	NC_000008.11:g.56980116C>G	ExAC,TOPMed,gnomAD
rs777781538	p.Thr160Ala	missense variant	-	NC_000008.11:g.56980107T>C	ExAC,gnomAD
rs1334963797	p.Pro161Ala	missense variant	-	NC_000008.11:g.56980104G>C	gnomAD
NCI-TCGA novel	p.Glu163Gln	missense variant	-	NC_000008.11:g.56980098C>G	NCI-TCGA
NCI-TCGA novel	p.Glu163Ter	stop gained	-	NC_000008.11:g.56980098C>A	NCI-TCGA
rs755239746	p.Pro165Ala	missense variant	-	NC_000008.11:g.56980092G>C	ExAC,TOPMed,gnomAD
rs746962174	p.Glu167Asp	missense variant	-	NC_000008.11:g.56980084T>A	ExAC,gnomAD
NCI-TCGA novel	p.Thr170Ile	missense variant	-	NC_000008.11:g.56980076G>A	NCI-TCGA
rs779777456	p.Ile173Val	missense variant	-	NC_000008.11:g.56980068T>C	ExAC,gnomAD
rs758221934	p.Asp174Glu	missense variant	-	NC_000008.11:g.56980063G>T	ExAC,TOPMed,gnomAD
rs758221934	p.Asp174Glu	missense variant	-	NC_000008.11:g.56980063G>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Asp174GlyPheSerTerUnkUnk	frameshift	-	NC_000008.11:g.56980047_56980066GTGTAGCATCAAGTGGGTCA>-	NCI-TCGA
NCI-TCGA novel	p.Asp174His	missense variant	-	NC_000008.11:g.56980065C>G	NCI-TCGA
rs1448995954	p.Pro175Ala	missense variant	-	NC_000008.11:g.56980062G>C	gnomAD
rs387907101	p.Asp177Asn	missense variant	Chondrodysplasia with joint dislocations, GPAPP type (CDP-GPAPP)	NC_000008.11:g.56980056C>T	UniProt,dbSNP
VAR_065847	p.Asp177Asn	missense variant	Chondrodysplasia with joint dislocations, GPAPP type (CDP-GPAPP)	NC_000008.11:g.56980056C>T	UniProt
rs387907101	p.Asp177Asn	missense variant	-	NC_000008.11:g.56980056C>T	-
RCV000024085	p.Asp177Asn	missense variant	Chondrodysplasia with joint dislocations, GPAPP type	NC_000008.11:g.56980056C>T	ClinVar
rs1207958863	p.Ala178Asp	missense variant	-	NC_000008.11:g.56980052G>T	gnomAD
rs1017662026	p.Tyr182His	missense variant	-	NC_000008.11:g.56980041A>G	TOPMed
rs387907102	p.Thr183Pro	missense variant	Chondrodysplasia with joint dislocations, GPAPP type (CDP-GPAPP)	NC_000008.11:g.56980038T>G	UniProt,dbSNP
VAR_065848	p.Thr183Pro	missense variant	Chondrodysplasia with joint dislocations, GPAPP type (CDP-GPAPP)	NC_000008.11:g.56980038T>G	UniProt
rs387907102	p.Thr183Pro	missense variant	-	NC_000008.11:g.56980038T>G	-
RCV000024086	p.Thr183Pro	missense variant	Chondrodysplasia with joint dislocations, GPAPP type	NC_000008.11:g.56980038T>G	ClinVar
NCI-TCGA novel	p.Glu184Lys	missense variant	-	NC_000008.11:g.56980035C>T	NCI-TCGA
NCI-TCGA novel	p.Asp185Ala	missense variant	-	NC_000008.11:g.56978142T>G	NCI-TCGA
rs387907103	p.Arg187Ter	stop gained	-	NC_000008.11:g.56978137G>A	-
rs139520829	p.Arg187Gln	missense variant	-	NC_000008.11:g.56978136C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs139520829	p.Arg187Gln	missense variant	-	NC_000008.11:g.56978136C>T	NCI-TCGA,NCI-TCGA Cosmic
RCV000578745	p.Arg187Ter	nonsense	-	NC_000008.11:g.56978137G>A	ClinVar
RCV000024087	p.Arg187Ter	nonsense	Chondrodysplasia with joint dislocations, GPAPP type	NC_000008.11:g.56978137G>A	ClinVar
rs756871234	p.Lys188Arg	missense variant	-	NC_000008.11:g.56978133T>C	ExAC,gnomAD
rs376319160	p.Val190Ile	missense variant	-	NC_000008.11:g.56978128C>T	ESP,ExAC,TOPMed,gnomAD
rs185977778	p.Thr192Ser	missense variant	-	NC_000008.11:g.56978121G>C	1000Genomes
rs1038427248	p.Met193Val	missense variant	-	NC_000008.11:g.56978119T>C	TOPMed
rs1038427248	p.Met193Leu	missense variant	-	NC_000008.11:g.56978119T>G	TOPMed
rs752301054	p.Met193Thr	missense variant	-	NC_000008.11:g.56978118A>G	ExAC,gnomAD
rs1243284607	p.Val194Leu	missense variant	-	NC_000008.11:g.56978116C>A	TOPMed
rs760025895	p.Cys195Arg	missense variant	-	NC_000008.11:g.56978113A>G	ExAC,gnomAD
NCI-TCGA novel	p.Cys195Phe	missense variant	-	NC_000008.11:g.56978112C>A	NCI-TCGA
rs751885193	p.Val196Gly	missense variant	-	NC_000008.11:g.56978109A>C	ExAC,gnomAD
rs1186052075	p.Val198Ile	missense variant	-	NC_000008.11:g.56978104C>T	TOPMed
COSM3650010	p.Val198Glu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.56978103A>T	NCI-TCGA Cosmic
rs553280526	p.Pro202Thr	missense variant	-	NC_000008.11:g.56978092G>T	1000Genomes,ExAC,gnomAD
rs553280526	p.Pro202Ser	missense variant	-	NC_000008.11:g.56978092G>A	1000Genomes,ExAC,gnomAD
NCI-TCGA novel	p.Pro202Leu	missense variant	-	NC_000008.11:g.56978091G>A	NCI-TCGA
rs1422759885	p.Met203Thr	missense variant	-	NC_000008.11:g.56978088A>G	TOPMed
rs761861820	p.Met203Val	missense variant	-	NC_000008.11:g.56978089T>C	ExAC,TOPMed,gnomAD
rs139335977	p.Gly205Glu	missense variant	-	NC_000008.11:g.56978082C>T	ESP,TOPMed
rs1257764999	p.Val206Ile	missense variant	-	NC_000008.11:g.56978080C>T	TOPMed,gnomAD
rs536533447	p.Ile207Val	missense variant	-	NC_000008.11:g.56978077T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs1319915788	p.Lys209Glu	missense variant	-	NC_000008.11:g.56978071T>C	TOPMed
NCI-TCGA novel	p.Pro210Ser	missense variant	-	NC_000008.11:g.56978068G>A	NCI-TCGA
COSM2719625	p.Ser212Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.56978061G>A	NCI-TCGA Cosmic
rs770658609	p.Glu213Ter	stop gained	-	NC_000008.11:g.56978059C>A	ExAC,gnomAD
rs770658609	p.Glu213Lys	missense variant	-	NC_000008.11:g.56978059C>T	ExAC,gnomAD
rs770658609	p.Glu213Lys	missense variant	-	NC_000008.11:g.56978059C>T	NCI-TCGA,NCI-TCGA Cosmic
rs777543066	p.Thr215Arg	missense variant	-	NC_000008.11:g.56978052G>C	ExAC,gnomAD
rs769502331	p.Trp217Cys	missense variant	-	NC_000008.11:g.56966348C>A	ExAC,gnomAD
NCI-TCGA novel	p.Trp217Ter	stop gained	-	NC_000008.11:g.56966349_56966350insTTCTT	NCI-TCGA
rs376366002	p.Ala218Ser	missense variant	-	NC_000008.11:g.56966347C>A	ESP,TOPMed,gnomAD
RCV000288038	p.Ala218Ser	missense variant	Chondrodysplasia	NC_000008.11:g.56966347C>A	ClinVar
NCI-TCGA novel	p.Ala218Thr	missense variant	-	NC_000008.11:g.56966347C>T	NCI-TCGA
rs780703417	p.Met219Ile	missense variant	-	NC_000008.11:g.56966342C>T	ExAC,gnomAD
rs747815279	p.Met219Val	missense variant	-	NC_000008.11:g.56966344T>C	ExAC,TOPMed,gnomAD
rs754477347	p.Gly223Val	missense variant	-	NC_000008.11:g.56966331C>A	ExAC,TOPMed,gnomAD
rs1021983291	p.Ala228Pro	missense variant	-	NC_000008.11:g.56966317C>G	gnomAD
rs1021983291	p.Ala228Thr	missense variant	-	NC_000008.11:g.56966317C>T	gnomAD
rs1410968908	p.Ala228Val	missense variant	-	NC_000008.11:g.56966316G>A	gnomAD
rs1046663	p.Arg229Cys	missense variant	-	NC_000008.11:g.56966314G>A	ESP,ExAC,TOPMed,gnomAD
rs758965196	p.Arg229His	missense variant	-	NC_000008.11:g.56966313C>T	ExAC,TOPMed,gnomAD
rs1046663	p.Arg229Ser	missense variant	-	NC_000008.11:g.56966314G>T	ESP,ExAC,TOPMed,gnomAD
rs750786108	p.Ser231Tyr	missense variant	-	NC_000008.11:g.56966307G>T	ExAC,gnomAD
rs1406787822	p.Asn233Ser	missense variant	-	NC_000008.11:g.56966301T>C	TOPMed,gnomAD
rs778956808	p.Lys235Glu	missense variant	-	NC_000008.11:g.56966296T>C	ExAC,TOPMed,gnomAD
rs367881909	p.Lys235Arg	missense variant	-	NC_000008.11:g.56966295T>C	ESP,ExAC,TOPMed,gnomAD
COSM1100689	p.Lys235Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.56966294C>A	NCI-TCGA Cosmic
rs1407637616	p.Arg238Lys	missense variant	-	NC_000008.11:g.56966286C>T	gnomAD
rs764414017	p.Arg238Gly	missense variant	-	NC_000008.11:g.56966287T>C	ExAC,TOPMed
rs1253797528	p.Ile239Phe	missense variant	-	NC_000008.11:g.56966284T>A	gnomAD
rs775694914	p.Val240Ile	missense variant	-	NC_000008.11:g.56966281C>T	ExAC,TOPMed,gnomAD
rs953424431	p.Ser242Cys	missense variant	-	NC_000008.11:g.56966274G>C	TOPMed,gnomAD
rs953424431	p.Ser242Phe	missense variant	-	NC_000008.11:g.56966274G>A	TOPMed,gnomAD
rs750461430	p.Arg243Cys	missense variant	-	NC_000008.11:g.56966272G>A	ExAC,TOPMed,gnomAD
rs148507660	p.Arg243His	missense variant	-	NC_000008.11:g.56966271C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs1229333132	p.Ser246Ala	missense variant	-	NC_000008.11:g.56966263A>C	gnomAD
COSM3650007	p.Ser246Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.56966262G>A	NCI-TCGA Cosmic
rs1331666989	p.Gly247Arg	missense variant	-	NC_000008.11:g.56966260C>T	gnomAD
NCI-TCGA novel	p.Gly247Trp	missense variant	-	NC_000008.11:g.56966260C>A	NCI-TCGA
NCI-TCGA novel	p.Met248Thr	missense variant	-	NC_000008.11:g.56966256A>G	NCI-TCGA
rs1165697396	p.Val252Gly	missense variant	-	NC_000008.11:g.56966244A>C	TOPMed,gnomAD
rs1286959037	p.Val252Leu	missense variant	-	NC_000008.11:g.56966245C>G	gnomAD
rs747764009	p.Ala253Ser	missense variant	-	NC_000008.11:g.56966242C>A	ExAC,TOPMed,gnomAD
rs747764009	p.Ala253Thr	missense variant	-	NC_000008.11:g.56966242C>T	ExAC,TOPMed,gnomAD
rs776116783	p.Gln255Glu	missense variant	-	NC_000008.11:g.56966236G>C	ExAC,gnomAD
rs768405549	p.Thr256Ala	missense variant	-	NC_000008.11:g.56966233T>C	ExAC,TOPMed,gnomAD
rs562200224	p.Thr256Ile	missense variant	-	NC_000008.11:g.56966232G>A	1000Genomes,ExAC,gnomAD
rs1457534707	p.Phe257Ser	missense variant	-	NC_000008.11:g.56966229A>G	gnomAD
rs779684307	p.Phe257Val	missense variant	-	NC_000008.11:g.56966230A>C	ExAC,gnomAD
rs898309252	p.Gln260His	missense variant	-	NC_000008.11:g.56966219C>G	TOPMed
rs1195420304	p.Gln260Ter	stop gained	-	NC_000008.11:g.56966221G>A	gnomAD
rs745323535	p.Ile263Val	missense variant	-	NC_000008.11:g.56966212T>C	ExAC,TOPMed,gnomAD
COSM1100688	p.Ile263Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.56966212T>G	NCI-TCGA Cosmic
rs1165691902	p.Pro265Gln	missense variant	-	NC_000008.11:g.56966205G>T	TOPMed
rs1252537616	p.Ala266Val	missense variant	-	NC_000008.11:g.56966202G>A	gnomAD
rs764206111	p.Gly268Ser	missense variant	-	NC_000008.11:g.56966197C>T	ExAC,gnomAD
rs1466492099	p.Gly268Asp	missense variant	-	NC_000008.11:g.56966196C>T	gnomAD
rs756422743	p.Ala269Ser	missense variant	-	NC_000008.11:g.56966194C>A	ExAC,TOPMed,gnomAD
rs756422743	p.Ala269Thr	missense variant	-	NC_000008.11:g.56966194C>T	ExAC,TOPMed,gnomAD
COSM71163	p.Ala269Gly	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.56966193G>C	NCI-TCGA Cosmic
rs756231127	p.Val273Ile	missense variant	-	NC_000008.11:g.56964056C>T	ExAC,gnomAD
rs752984748	p.Asp278Gly	missense variant	-	NC_000008.11:g.56964040T>C	ExAC,TOPMed,gnomAD
rs781380828	p.Val279Met	missense variant	-	NC_000008.11:g.56964038C>T	ExAC,gnomAD
rs1253080787	p.Val279Gly	missense variant	-	NC_000008.11:g.56964037A>C	gnomAD
rs1455815981	p.Pro280Thr	missense variant	-	NC_000008.11:g.56964035G>T	TOPMed
rs755077755	p.Pro280Arg	missense variant	-	NC_000008.11:g.56964034G>C	ExAC,gnomAD
COSM3900785	p.Pro280Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.56964034G>A	NCI-TCGA Cosmic
rs1483722374	p.Asp281Asn	missense variant	-	NC_000008.11:g.56964032C>T	gnomAD
NCI-TCGA novel	p.Asp281Tyr	missense variant	-	NC_000008.11:g.56964032C>A	NCI-TCGA
rs751739178	p.Ser283Asn	missense variant	-	NC_000008.11:g.56964025C>T	ExAC,gnomAD
rs765253748	p.Glu285Gly	missense variant	-	NC_000008.11:g.56964019T>C	ExAC,gnomAD
rs112433249	p.Lys286Glu	missense variant	-	NC_000008.11:g.56964017T>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000346686	p.Lys286Glu	missense variant	Chondrodysplasia	NC_000008.11:g.56964017T>C	ClinVar
COSM1457608	p.Ala287Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.56964013G>A	NCI-TCGA Cosmic
rs755483771	p.Val293Met	missense variant	-	NC_000008.11:g.56963996C>T	ExAC,TOPMed,gnomAD
rs763967311	p.Val293Glu	missense variant	-	NC_000008.11:g.56963995A>T	ExAC,gnomAD
rs1322076069	p.Thr294Ala	missense variant	-	NC_000008.11:g.56963993T>C	TOPMed
rs1331030877	p.Thr294Arg	missense variant	-	NC_000008.11:g.56963992G>C	TOPMed
rs1226146739	p.Tyr295Cys	missense variant	-	NC_000008.11:g.56963989T>C	TOPMed
NCI-TCGA novel	p.Tyr295SerPheSerTerUnkUnk	frameshift	-	NC_000008.11:g.56963989_56963990insG	NCI-TCGA
rs775242998	p.Ile296Val	missense variant	-	NC_000008.11:g.56963987T>C	ExAC,gnomAD
rs759030684	p.Trp299Gly	missense variant	-	NC_000008.11:g.56963978A>C	ExAC,gnomAD
rs1279479463	p.Cys302Tyr	missense variant	-	NC_000008.11:g.56963968C>T	gnomAD
rs1393066587	p.Gly304Arg	missense variant	-	NC_000008.11:g.56963963C>G	gnomAD
rs1324153760	p.Gly304Val	missense variant	-	NC_000008.11:g.56963962C>A	gnomAD
rs373619609	p.Asn305Ser	missense variant	-	NC_000008.11:g.56963959T>C	ESP,ExAC,TOPMed,gnomAD
rs373619609	p.Asn305Ile	missense variant	-	NC_000008.11:g.56963959T>A	ESP,ExAC,TOPMed,gnomAD
rs777949538	p.Ala306Val	missense variant	-	NC_000008.11:g.56963956G>A	ExAC,TOPMed,gnomAD
COSM281920	p.Ala306Gly	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.56963956G>C	NCI-TCGA Cosmic
rs748501972	p.Ile307Val	missense variant	-	NC_000008.11:g.56963954T>C	ExAC,gnomAD
rs1222269578	p.Ile307Met	missense variant	-	NC_000008.11:g.56963952G>C	TOPMed
rs370198289	p.Gly312Ala	missense variant	-	NC_000008.11:g.56963938C>G	ESP,ExAC,TOPMed,gnomAD
rs370198289	p.Gly312Glu	missense variant	-	NC_000008.11:g.56963938C>T	ESP,ExAC,TOPMed,gnomAD
rs755310573	p.Gly312Arg	missense variant	-	NC_000008.11:g.56963939C>T	ExAC,TOPMed,gnomAD
rs1176339832	p.Thr317Ala	missense variant	-	NC_000008.11:g.56963924T>C	gnomAD
rs1161523443	p.Leu318Val	missense variant	-	NC_000008.11:g.56963921G>C	TOPMed
rs763761420	p.Ser319Asn	missense variant	-	NC_000008.11:g.56963917C>T	ExAC,gnomAD
COSM6113640	p.Gly320Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.56963914C>A	NCI-TCGA Cosmic
rs1390174328	p.Glu321Lys	missense variant	-	NC_000008.11:g.56963912C>T	TOPMed
RCV000385632	p.Glu322Lys	missense variant	Chondrodysplasia	NC_000008.11:g.56963909C>T	ClinVar
rs1348540270	p.Glu322Asp	missense variant	-	NC_000008.11:g.56963907T>G	gnomAD
rs76235334	p.Glu322Lys	missense variant	-	NC_000008.11:g.56963909C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
RCV000598819	p.Ser324Ter	frameshift	-	NC_000008.11:g.56963900_56963901del	ClinVar
rs1278891844	p.Ser324Asn	missense variant	-	NC_000008.11:g.56963902C>T	gnomAD
RCV000331187	p.Gly330Ser	missense variant	Chondrodysplasia	NC_000008.11:g.56963885C>T	ClinVar
rs773790200	p.Gly330Val	missense variant	-	NC_000008.11:g.56963884C>A	ExAC
rs138502852	p.Gly330Ser	missense variant	-	NC_000008.11:g.56963885C>T	ESP,ExAC,TOPMed,gnomAD
rs765934902	p.Ile331Val	missense variant	-	NC_000008.11:g.56963882T>C	ExAC,gnomAD
rs763327486	p.Gly333Val	missense variant	-	NC_000008.11:g.56963875C>A	ExAC,gnomAD
rs1173682845	p.Ile339Val	missense variant	-	NC_000008.11:g.56963858T>C	gnomAD
rs1478039395	p.Gln344Lys	missense variant	-	NC_000008.11:g.56963843G>T	TOPMed,gnomAD
rs1396407759	p.Gln344Arg	missense variant	-	NC_000008.11:g.56963842T>C	gnomAD
rs770253673	p.Ala345Asp	missense variant	-	NC_000008.11:g.56963839G>T	ExAC,gnomAD
rs1481912856	p.Val347Phe	missense variant	-	NC_000008.11:g.56963834C>A	TOPMed
rs1181775163	p.Arg348Gly	missense variant	-	NC_000008.11:g.56963831T>C	gnomAD
rs1038937444	p.Pro351Leu	missense variant	-	NC_000008.11:g.56963821G>A	TOPMed
rs560353101	p.Asp352His	missense variant	-	NC_000008.11:g.56963819C>G	1000Genomes,ExAC,gnomAD
NCI-TCGA novel	p.Asp352Tyr	missense variant	-	NC_000008.11:g.56963819C>A	NCI-TCGA
rs1185736896	p.Glu354Gln	missense variant	-	NC_000008.11:g.56963813C>G	TOPMed
rs1200998344	p.Glu354Gly	missense variant	-	NC_000008.11:g.56963812T>C	gnomAD
NCI-TCGA novel	p.Glu354Asp	missense variant	-	NC_000008.11:g.56963811T>G	NCI-TCGA
rs1367924061	p.Lys355Glu	missense variant	-	NC_000008.11:g.56963810T>C	TOPMed
COSM1100687	p.Lys355Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000008.11:g.56963809T>C	NCI-TCGA Cosmic
rs201175538	p.Thr356Ala	missense variant	-	NC_000008.11:g.56963807T>C	ESP,ExAC,TOPMed,gnomAD
rs1165957845	p.Gly357Arg	missense variant	-	NC_000008.11:g.56963804C>G	TOPMed
NCI-TCGA novel	p.Gly357Glu	missense variant	-	NC_000008.11:g.56963803C>T	NCI-TCGA
rs546293123	p.His358Arg	missense variant	-	NC_000008.11:g.56963800T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs546293123	p.His358Leu	missense variant	-	NC_000008.11:g.56963800T>A	1000Genomes,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.His358Asn	missense variant	-	NC_000008.11:g.56963801G>T	NCI-TCGA

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0011053	Deafness	phenotype	HPO
C0015300	Exophthalmos	disease	HPO
C0018772	Hearing Loss, Partial	phenotype	HPO
C0023418	leukemia	disease	BEFREE
C0024623	Malignant neoplasm of stomach	disease	BEFREE
C0025990	Micrognathism	disease	HPO
C0026034	Microstomia	disease	HPO
C0038356	Stomach Neoplasms	group	BEFREE
C0221357	Brachydactyly	disease	HPO
C0239676	High forehead	phenotype	HPO
C0278701	Gastric Adenocarcinoma	disease	BEFREE
C0339789	Congenital deafness	disease	HPO
C0343284	Chondrodysplasia	disease	BEFREE
C0349588	Short stature	phenotype	HPO
C0426414	Small nose	phenotype	HPO
C0576093	Knee joint valgus deformity	phenotype	HPO
C0699791	Stomach Carcinoma	disease	BEFREE
C1135812	Patellar Dislocation	disease	HPO
C1384666	hearing impairment	phenotype	HPO
C1836195	Short toe	phenotype	HPO
C1837084	Short metacarpal	phenotype	HPO
C1837760	Prominent eyes	phenotype	HPO
C1839764	Broad flat nasal bridge	phenotype	HPO
C1848490	Protruding eyes	phenotype	HPO
C1848673	Hypoplastic feet	phenotype	HPO
C1849367	Nasal bridge wide	phenotype	HPO
C1853241	Flat face	phenotype	HPO
C1854114	Short nose	phenotype	HPO
C1856266	Coronal craniosynostosis	disease	HPO
C1857130	Hypoplastic mandible condyle	phenotype	HPO
C1862425	Prominent globes	phenotype	HPO
C3279757	CHONDRODYSPLASIA WITH JOINT DISLOCATIONS, GPAPP TYPE	disease	BEFREE;CLINVAR;CTD_human;ORPHANET;UNIPROT
C3714756	Intellectual Disability	group	GENOMICS_ENGLAND
C4024589	Aplasia/Hypoplasia of the mandible	phenotype	HPO
C4476523	Decreased projection of lower jaw	phenotype	HPO
C4476524	Decreased projection of mandible	phenotype	HPO
C4476525	Retrusion of lower jaw	phenotype	HPO

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0008254	3'-nucleotidase activity	IBA
GO:0008441	3'(2'),5'-bisphosphate nucleotidase activity	IEA
GO:0046872	metal ion binding	IEA
GO:0097657	3',5'-nucleotide bisphosphate phosphatase activity	ISS

GO:Biological Process

GO ID	GO Term	Evidence
GO:0001501	skeletal system development	IBA
GO:0001958	endochondral ossification	IEA
GO:0002063	chondrocyte development	IEA
GO:0009791	post-embryonic development	IEA
GO:0016311	dephosphorylation	IEA
GO:0030204	chondroitin sulfate metabolic process	IEA
GO:0042733	embryonic digit morphogenesis	IEA
GO:0046854	phosphatidylinositol phosphorylation	IEA
GO:0050427	3'-phosphoadenosine 5'-phosphosulfate metabolic process	TAS

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0005654	nucleoplasm	IDA
GO:0005794	Golgi apparatus	IDA
GO:0005796	Golgi lumen	TAS
GO:0005829	cytosol	IDA
GO:0012505	endomembrane system	IBA
GO:0016020	membrane	HDA
GO:0016021	integral component of membrane	IEA
GO:0016604	nuclear body	IDA
GO:0032588	trans-Golgi network membrane	ISS

Reactome Pathway

Reactome ID	Reactome Term	Evidence
R-HSA-1430728	Metabolism	TAS
R-HSA-156580	Phase II - Conjugation of compounds	TAS
R-HSA-156584	Cytosolic sulfonation of small molecules	TAS
R-HSA-211859	Biological oxidations	TAS

Drugs and compounds information

ID	Drug Name	Action	PubMed
C028474	1,4-bis(2-(3,5-dichloropyridyloxy))benzene	1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of IMPAD1 mRNA	28903501
D015056	1-Methyl-3-isobutylxanthine	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bis(4-hydroxyphenyl)sulfone] results in increased expression of IMPAD1 mRNA	28628672
D015056	1-Methyl-3-isobutylxanthine	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of IMPAD1 mRNA	28628672
D015056	1-Methyl-3-isobutylxanthine	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of IMPAD1 mRNA	28628672
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of IMPAD1 mRNA	27188386
C459179	4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of IMPAD1 mRNA	27188386
C496492	abrine	abrine results in decreased expression of IMPAD1 mRNA	31054353
D000082	Acetaminophen	Acetaminophen results in decreased expression of IMPAD1 mRNA	22230336
D000082	Acetaminophen	Acetaminophen affects the expression of IMPAD1 mRNA	17562736
D020106	Acrylamide	Acrylamide results in increased expression of IMPAD1 mRNA	28959563
D016604	Aflatoxin B1	Aflatoxin B1 results in decreased expression of IMPAD1 mRNA	19770486
D018501	Antirheumatic Agents	Antirheumatic Agents results in increased expression of IMPAD1 mRNA	24449571
C547126	AZM551248	AZM551248 results in increased expression of IMPAD1 mRNA	22323515
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in increased expression of IMPAD1 mRNA	26238291
D001564	Benzo(a)pyrene	Benzo(a)pyrene results in decreased expression of IMPAD1 mRNA	22300585
C543008	bis(4-hydroxyphenyl)sulfone	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bis(4-hydroxyphenyl)sulfone] results in increased expression of IMPAD1 mRNA	28628672
C006780	bisphenol A	bisphenol A affects the expression of IMPAD1 mRNA	21786754
C006780	bisphenol A	bisphenol A results in increased expression of IMPAD1 mRNA	30248606
C006780	bisphenol A	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of IMPAD1 mRNA	28628672
C006780	bisphenol A	bisphenol A results in increased expression of IMPAD1 mRNA	25181051; 30816183;
C000611646	bisphenol F	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of IMPAD1 mRNA	28628672
C018475	butyraldehyde	butyraldehyde results in decreased expression of IMPAD1 mRNA	26079696
D002220	Carbamazepine	Carbamazepine affects the expression of IMPAD1 mRNA	25979313
D002251	Carbon Tetrachloride	Carbon Tetrachloride results in increased expression of IMPAD1 mRNA	27339419
D002762	Cholecalciferol	Cholecalciferol results in increased expression of IMPAD1 mRNA	16508948
D002794	Choline	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of IMPAD1 mRNA	20938992
D002945	Cisplatin	Cisplatin results in decreased expression of IMPAD1 mRNA	27594783
D003561	Cytarabine	Cytarabine results in decreased expression of IMPAD1 mRNA	21198554
D003907	Dexamethasone	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bis(4-hydroxyphenyl)sulfone] results in increased expression of IMPAD1 mRNA	28628672
D003907	Dexamethasone	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of IMPAD1 mRNA	28628672
D003907	Dexamethasone	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of IMPAD1 mRNA	28628672
C015835	dimethyl-4-toluidine	dimethyl-4-toluidine results in decreased expression of IMPAD1 mRNA	27638505
C516138	dorsomorphin	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of IMPAD1 mRNA	27188386
C516138	dorsomorphin	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of IMPAD1 mRNA	27188386
D004317	Doxorubicin	Doxorubicin results in decreased expression of IMPAD1 mRNA	29803840
C045651	epigallocatechin gallate	[potassium chromate(VI) co-treated with epigallocatechin gallate] results in increased expression of IMPAD1 mRNA	22079256
D005020	Ethyl Methanesulfonate	Ethyl Methanesulfonate results in decreased expression of IMPAD1 mRNA	23649840
D005485	Flutamide	Flutamide results in increased expression of IMPAD1 mRNA	24136188
D005492	Folic Acid	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of IMPAD1 mRNA	20938992
D005557	Formaldehyde	Formaldehyde results in decreased expression of IMPAD1 mRNA	23649840
D006861	Hydrogen Peroxide	Hydrogen Peroxide affects the expression of IMPAD1 mRNA	20044591
D007213	Indomethacin	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bis(4-hydroxyphenyl)sulfone] results in increased expression of IMPAD1 mRNA	28628672
D007213	Indomethacin	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of IMPAD1 mRNA	28628672
D007213	Indomethacin	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of IMPAD1 mRNA	28628672
D007213	Indomethacin	Indomethacin results in increased expression of IMPAD1 mRNA	28201806
D015759	Ionomycin	[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in increased expression of IMPAD1 mRNA	25613284
C544151	jinfukang	jinfukang results in decreased expression of IMPAD1 mRNA	27392435
D058185	Magnetite Nanoparticles	[Succimer co-treated with Magnetite Nanoparticles] results in decreased expression of IMPAD1 mRNA	26378955
D008701	Methapyrilene	Methapyrilene results in decreased expression of IMPAD1 mRNA	30467583
D008715	Methionine	[Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of IMPAD1 mRNA	20938992
D008777	Methyltestosterone	Methyltestosterone results in decreased expression of IMPAD1 mRNA	29191790
C028473	N-acetyl-4-benzoquinoneimine	IMPAD1 gene SNP affects the susceptibility to N-acetyl-4-benzoquinoneimine	21177773
C051752	nefazodone	nefazodone results in increased expression of IMPAD1 mRNA	24136188
D009532	Nickel	Nickel results in increased expression of IMPAD1 mRNA	24768652; 25583101;
D018817	N-Methyl-3,4-methylenedioxyamphetamine	N-Methyl-3,4-methylenedioxyamphetamine results in decreased expression of IMPAD1 mRNA	26251327
D010426	Pentosan Sulfuric Polyester	Pentosan Sulfuric Polyester results in decreased expression of IMPAD1 mRNA	28973697
D010634	Phenobarbital	Phenobarbital affects the expression of IMPAD1 mRNA	23091169
D010662	Phenylmercuric Acetate	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of IMPAD1 mRNA	27188386
D010662	Phenylmercuric Acetate	Phenylmercuric Acetate results in increased expression of IMPAD1 mRNA	26272509
D010936	Plant Extracts	Plant Extracts results in increased expression of IMPAD1 mRNA	23557933
C027373	potassium chromate(VI)	[potassium chromate(VI) co-treated with epigallocatechin gallate] results in increased expression of IMPAD1 mRNA	22079256
C027373	potassium chromate(VI)	potassium chromate(VI) results in increased expression of IMPAD1 mRNA	22079256
D011374	Progesterone	Progesterone results in decreased expression of IMPAD1 mRNA	23012394
C045950	propiconazole	propiconazole results in decreased expression of IMPAD1 mRNA	21278054
D012822	Silicon Dioxide	Silicon Dioxide results in decreased expression of IMPAD1 mRNA	19073995
C009277	sodium arsenate	sodium arsenate results in increased expression of IMPAD1 mRNA	21795629; 30953684;
C017947	sodium arsenite	sodium arsenite results in decreased expression of IMPAD1 mRNA	22714537
C017947	sodium arsenite	sodium arsenite results in increased expression of IMPAD1 mRNA	28595984
D004113	Succimer	[Succimer co-treated with Magnetite Nanoparticles] results in decreased expression of IMPAD1 mRNA	26378955
D013749	Tetrachlorodibenzodioxin	Tetrachlorodibenzodioxin affects the expression of IMPAD1 mRNA	21570461; 24680724;
D013755	Tetradecanoylphorbol Acetate	[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in increased expression of IMPAD1 mRNA	25613284
C015559	trimellitic anhydride	trimellitic anhydride results in increased expression of IMPAD1 mRNA	19042947
D014302	Trinitrobenzenesulfonic Acid	Trinitrobenzenesulfonic Acid results in decreased expression of IMPAD1 mRNA	17982090
D000077288	Troglitazone	Troglitazone results in decreased expression of IMPAD1 mRNA	28973697
D014635	Valproic Acid	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of IMPAD1 mRNA	27188386
D014635	Valproic Acid	Valproic Acid affects the expression of IMPAD1 mRNA	25979313
D014635	Valproic Acid	Valproic Acid results in increased expression of IMPAD1 mRNA	23179753; 24383497; 24935251; 25192806; 26272509; 28001369;
D014635	Valproic Acid	Valproic Acid affects the expression of IMPAD1 mRNA	17292431
D014635	Valproic Acid	Valproic Acid affects the splicing of IMPAD1 mRNA	29427782
C025643	vinclozolin	vinclozolin affects the expression of IMPAD1 mRNA	19015723

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0007	Acetylation
KW-0225	Disease mutation
KW-0325	Glycoprotein
KW-0333	Golgi apparatus
KW-0378	Hydrolase
KW-0460	Magnesium
KW-0472	Membrane
KW-0479	Metal-binding
KW-1185	Reference proteome
KW-0735	Signal-anchor
KW-0812	Transmembrane
KW-1133	Transmembrane helix

Interpro

InterPro ID	InterPro Term
IPR000760	Inositol_monophosphatase-like
IPR020550	Inositol_monophosphatase_CS

PROSITE

PROSITE ID	PROSITE Term
PS00630	IMP_2

Pfam

Pfam ID	Pfam Term
PF00459	Inositol_P