CleftGeneDB-Search

Gene: MORC2

Basic information

Tag	Content
Uniprot ID	Q9Y6X9; B2RNB1; Q9UF28; Q9Y6V2;
Entrez ID	22880
Genbank protein ID	CAB63760.1; AAH19257.3; AAC12954.1; BAA74875.2; AAI36783.1; CAG30355.1; EAW59921.1;
Genbank nucleotide ID	XM_017028668.1; NM_001303257.2; NM_001303256.2; NM_014941.3;
Ensembl protein ID	ENSP00000215862; ENSP00000380763;
Ensembl nucleotide ID	ENSG00000133422
Gene name	ATPase MORC2
Gene symbol	MORC2
Organism	Homo sapiens
NCBI taxa ID	9606
Cleft type
Developmental stage
Data sources	Homology search
Reference
Functional description	Essential for epigenetic silencing by the HUSH (human silencing hub) complex. Recruited by HUSH to target site in heterochromatin, the ATPase activity and homodimerization are critical for HUSH-mediated silencing (PubMed:28581500, PubMed:29440755). Represses germ cell-related genes and L1 retrotransposons in collaboration with SETDB1 and the HUSH complex, the silencing is dependent of repressive epigenetic modifications, such as H3K9me3 mark. Silencing events often occur within introns of transcriptionally active genes, and lead to the down-regulation of host gene expression (PubMed:29211708). During DNA damage response, regulates chromatin remodeling through ATP hydrolysis. Upon DNA damage, is phosphorylated by PAK1, both colocalize to chromatin and induce H2AX expression. ATPase activity is required and dependent of phosphorylation by PAK1 and presence of DNA (PubMed:23260667). Recruits histone deacetylases, such as HDAC4, to promoter regions, causing local histone H3 deacetylation and transcriptional repression of genes such as CA9 (PubMed:20225202, PubMed:20110259). Exhibits a cytosolic function in lipogenesis, adipogenic differentiation, and lipid homeostasis by increasing the activity of ACLY, possibly preventing its dephosphorylation (PubMed:24286864).
Sequence	MAFTNYSSLN RAQLTFEYLH TNSTTHEFLF GALAELVDNA RDADATRIDI YAERREDLRG 60 GFMLCFLDDG AGMDPSDAAS VIQFGKSAKR TPESTQIGQY GNGLKSGSMR IGKDFILFTK 120 KEDTMTCLFL SRTFHEEEGI DEVIVPLPTW NARTREPVTD NVEKFAIETE LIYKYSPFRT 180 EEEVMTQFMK IPGDSGTLVI IFNLKLMDNG EPELDIISNP RDIQMAETSP EGTKPERRSF 240 RAYAAVLYID PRMRIFIHGH KVQTKRLSCC LYKPRMYKYT SSRFKTRAEQ EVKKAEHVAR 300 IAEEKAREAE SKARTLEVRL GGDLTRDSRV MLRQVQNRAI TLRREADVKK RIKEAKQRAL 360 KEPKELNFVF GVNIEHRDLD GMFIYNCSRL IKMYEKVGPQ LEGGMACGGV VGVVDVPYLV 420 LEPTHNKQDF ADAKEYRHLL RAMGEHLAQY WKDIAIAQRG IIKFWDEFGY LSANWNQPPS 480 SELRYKRRRA MEIPTTIQCD LCLKWRTLPF QLSSVEKDYP DTWVCSMNPD PEQDRCEASE 540 QKQKVPLGTF RKDMKTQEEK QKQLTEKIRQ QQEKLEALQK TTPIRSQADL KKLPLEVTTR 600 PSTEEPVRRP QRPRSPPLPA VIRNAPSRPP SLPTPRPASQ PRKAPVISST PKLPALAARE 660 EASTSRLLQP PEAPRKPANT LVKTASRPAP LVQQLSPSLL PNSKSPREVP SPKVIKTPVV 720 KKTESPIKLS PATPSRKRSV AVSDEEEVEE EAERRKERCK RGRFVVKEEK KDSNELSDSA 780 GEEDSADLKR AQKDKGLHVE VRVNREWYTG RVTAVEVGKH VVRWKVKFDY VPTDTTPRDR 840 WVEKGSEDVR LMKPPSPEHQ SLDTQQEGGE EEVGPVAQQA IAVAEPSTSE CLRIEPDTTA 900 LSTNHETIDL LVQILRNCLR YFLPPSFPIS KKQLSAMNSD ELISFPLKEY FKQYEVGLQN 960 LCNSYQSRAD SRAKASEESL RTSERKLRET EEKLQKLRTN IVALLQKVQE DIDINTDDEL 1020 DAYIEDLITK GD 1032

Abbreviation :
CLO : cleft lip only. CPO : cleft palate only. CLP : cleft lip and palate. CL/P : cleft lip with/without cleft palate.
For humans: CL/P, CLO, CPO, and CLP. For mice: CLO, CLP, and CPO.

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

PDB ID
5OF9
5OFA
5OFB
5OF9
5OFA

Protein disorder information

Orthologous information

Relation	Gene symbol	Entrez ID	UniProt ID	Cleft type	Species	Evidence	Details
1:1 ortholog	MORC2	486358	E2RBF9		Canis lupus familiaris	Prediction	More>>
1:1 ortholog	MORC2		A0A452FN52		Capra hircus	Prediction	More>>
1:1 ortholog	MORC2	22880	Q9Y6X9		Homo sapiens	Prediction	More>>
1:1 ortholog	Morc2a	74522	Q69ZX6	CPO	Mus musculus	Publication	More>>
1:1 ortholog	MORC2	458763	K7D393		Pan troglodytes	Prediction	More>>
1:1 ortholog	MORC2		F1RPD9		Sus scrofa	Prediction	More>>
1:1 ortholog	Morc2	289736	A0A0G2JWF7		Rattus norvegicus	Prediction	More>>
1:1 ortholog	morc2	445488	Q68EG7		Danio rerio	Prediction	More>>

Other genetic variants/mutations

ID	Variant	Type	Disease	Chromosome\Coordinate	Evidence
rs958734314	p.Ala2Val	missense variant	-	NC_000022.11:g.30967885G>A	TOPMed,gnomAD
rs958734314	p.Ala2Gly	missense variant	-	NC_000022.11:g.30967885G>C	TOPMed,gnomAD
rs1273255920	p.Thr4Ala	missense variant	-	NC_000022.11:g.30967880T>C	TOPMed
rs1467310640	p.Tyr6His	missense variant	-	NC_000022.11:g.30967874A>G	gnomAD
rs1213563782	p.Ser7Gly	missense variant	-	NC_000022.11:g.30967871T>C	TOPMed
rs1243735560	p.Asn10Ile	missense variant	-	NC_000022.11:g.30967861T>A	TOPMed
rs1034098965	p.Arg11Gln	missense variant	-	NC_000022.11:g.30967858C>T	TOPMed,gnomAD
rs1386472984	p.Ala12Gly	missense variant	-	NC_000022.11:g.30967855G>C	gnomAD
rs769126155	p.Gln13Ter	stop gained	-	NC_000022.11:g.30967853G>A	ExAC,gnomAD
rs1181048709	p.Thr15Ser	missense variant	-	NC_000022.11:g.30967847T>A	TOPMed
NCI-TCGA novel	p.Glu17Gln	missense variant	-	NC_000022.11:g.30967841C>G	NCI-TCGA
COSM4840492	p.Glu27Lys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000022.11:g.30958684C>T	NCI-TCGA Cosmic
rs1204561176	p.Phe30Leu	missense variant	-	NC_000022.11:g.30958675A>G	gnomAD
rs964012011	p.Ala32Thr	missense variant	-	NC_000022.11:g.30958669C>T	gnomAD
rs964012011	p.Ala32Ser	missense variant	-	NC_000022.11:g.30958669C>A	gnomAD
rs1368333018	p.Val37Phe	missense variant	-	NC_000022.11:g.30958654C>A	gnomAD
NCI-TCGA novel	p.Arg47Ile	missense variant	-	NC_000022.11:g.30956780C>A	NCI-TCGA
NCI-TCGA novel	p.Asp49Tyr	missense variant	-	NC_000022.11:g.30956775C>A	NCI-TCGA
rs1369209707	p.Ile50Phe	missense variant	-	NC_000022.11:g.30956772T>A	gnomAD
rs574524678	p.Arg55Gln	missense variant	-	NC_000022.11:g.30950439C>T	1000Genomes,ExAC,gnomAD
rs1452151243	p.Glu56Asp	missense variant	-	NC_000022.11:g.30950435C>G	gnomAD
rs760345377	p.Leu58Val	missense variant	-	NC_000022.11:g.30950431G>C	ExAC,gnomAD
rs1202793669	p.Arg59Ter	stop gained	-	NC_000022.11:g.30950428G>A	gnomAD
rs781481050	p.Arg59Gln	missense variant	-	NC_000022.11:g.30950427C>T	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gly61Val	missense variant	-	NC_000022.11:g.30950421C>A	NCI-TCGA
rs748092969	p.Met63Leu	missense variant	-	NC_000022.11:g.30950416T>A	ExAC,TOPMed,gnomAD
rs748092969	p.Met63Val	missense variant	-	NC_000022.11:g.30950416T>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gly70Glu	missense variant	-	NC_000022.11:g.30950394C>T	NCI-TCGA
RCV000530209	p.Asp74Gly	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30950382T>C	ClinVar
rs1555942389	p.Asp74Gly	missense variant	-	NC_000022.11:g.30950382T>C	-
rs768530375	p.Asp74Tyr	missense variant	-	NC_000022.11:g.30950383C>A	ExAC,TOPMed,gnomAD
rs898196410	p.Pro75Ser	missense variant	-	NC_000022.11:g.30950380G>A	TOPMed,gnomAD
rs762809030	p.Ser76Asn	missense variant	-	NC_000022.11:g.30949842C>T	ExAC,TOPMed,gnomAD
rs775429252	p.Ala78Val	missense variant	-	NC_000022.11:g.30949836G>A	ExAC,gnomAD
rs376351739	p.Ser80Gly	missense variant	-	NC_000022.11:g.30949831T>C	ESP,ExAC,TOPMed,gnomAD
rs1377160735	p.Val81Leu	missense variant	-	NC_000022.11:g.30949828C>A	gnomAD
rs1286183996	p.Ile82Val	missense variant	-	NC_000022.11:g.30949825T>C	gnomAD
COSM4860473	p.Gln83Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000022.11:g.30949822G>A	NCI-TCGA Cosmic
RCV000652685	p.Lys86Asn	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30949811C>G	ClinVar
rs150980372	p.Lys86Asn	missense variant	-	NC_000022.11:g.30949811C>G	ESP,ExAC,TOPMed,gnomAD
RCV000522454	p.Ser87Leu	missense variant	-	NC_000022.11:g.30949809G>A	ClinVar
RCV000202460	p.Ser87Leu	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30949809G>A	ClinVar
rs864309504	p.Ser87Leu	missense variant	Charcot-Marie-Tooth disease 2Z (CMT2Z)	NC_000022.11:g.30949809G>A	UniProt,dbSNP
VAR_076454	p.Ser87Leu	missense variant	Charcot-Marie-Tooth disease 2Z (CMT2Z)	NC_000022.11:g.30949809G>A	UniProt
rs864309504	p.Ser87Leu	missense variant	-	NC_000022.11:g.30949809G>A	-
NCI-TCGA novel	p.Lys89Arg	missense variant	-	NC_000022.11:g.30949803T>C	NCI-TCGA
NCI-TCGA novel	p.Arg90Gln	missense variant	-	NC_000022.11:g.30949800C>T	NCI-TCGA
rs374633215	p.Arg90Ter	stop gained	-	NC_000022.11:g.30949801G>A	gnomAD
COSM3992097	p.Thr95Pro	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000022.11:g.30949786T>G	NCI-TCGA Cosmic
RCV000658937	p.Gln96Glu	missense variant	-	NC_000022.11:g.30949783G>C	ClinVar
rs749060708	p.Gln96Glu	missense variant	-	NC_000022.11:g.30949783G>C	ExAC,gnomAD
COSM3553456	p.Gln99Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000022.11:g.30949773T>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Ser106Leu	missense variant	-	NC_000022.11:g.30949752G>A	NCI-TCGA
rs1165276920	p.Met109Thr	missense variant	-	NC_000022.11:g.30946441A>G	TOPMed,gnomAD
rs141387374	p.Met109Val	missense variant	-	NC_000022.11:g.30946442T>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs980180430	p.Arg110His	missense variant	-	NC_000022.11:g.30946438C>T	TOPMed,gnomAD
rs980180430	p.Arg110Leu	missense variant	-	NC_000022.11:g.30946438C>A	TOPMed,gnomAD
rs1169862798	p.Lys113Asn	missense variant	-	NC_000022.11:g.30946428C>G	gnomAD
rs747210413	p.Ile116Val	missense variant	-	NC_000022.11:g.30946421T>C	ExAC
rs542809980	p.Leu117Val	missense variant	-	NC_000022.11:g.30946418G>C	1000Genomes,ExAC,gnomAD
RCV000652681	p.Thr119Ala	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30946412T>C	ClinVar
rs748216749	p.Thr119Ala	missense variant	-	NC_000022.11:g.30946412T>C	ExAC,gnomAD
NCI-TCGA novel	p.Met125Thr	missense variant	-	NC_000022.11:g.30946393A>G	NCI-TCGA
rs199669947	p.Met125Ile	missense variant	-	NC_000022.11:g.30946392C>G	TOPMed
rs1223721150	p.Thr126Ala	missense variant	-	NC_000022.11:g.30946391T>C	gnomAD
rs755523808	p.Thr126Ile	missense variant	-	NC_000022.11:g.30946390G>A	ExAC,gnomAD
rs1223721150	p.Thr126Pro	missense variant	-	NC_000022.11:g.30946391T>G	gnomAD
rs751196420	p.Phe129Ser	missense variant	-	NC_000022.11:g.30946381A>G	ExAC,gnomAD
rs757957309	p.Leu130Val	missense variant	-	NC_000022.11:g.30946379G>C	ExAC,gnomAD
NCI-TCGA novel	p.Arg132His	missense variant	-	NC_000022.11:g.30946372C>T	NCI-TCGA
rs1064795559	p.Arg132Cys	missense variant	-	NC_000022.11:g.30946373G>A	-
RCV000480527	p.Arg132Cys	missense variant	-	NC_000022.11:g.30946373G>A	ClinVar
rs553943877	p.Thr133Met	missense variant	-	NC_000022.11:g.30946369G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs553943877	p.Thr133Lys	missense variant	-	NC_000022.11:g.30946369G>T	1000Genomes,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Phe134Cys	missense variant	-	NC_000022.11:g.30946366A>C	NCI-TCGA
rs144582460	p.His135Gln	missense variant	-	NC_000022.11:g.30946362A>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1376548988	p.Ile140Val	missense variant	-	NC_000022.11:g.30946349T>C	TOPMed,gnomAD
rs563571840	p.Ile144Thr	missense variant	-	NC_000022.11:g.30942267A>G	1000Genomes,ExAC,gnomAD
COSM1033343	p.Val145Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000022.11:g.30942265C>T	NCI-TCGA Cosmic
rs1319960845	p.Pro146Leu	missense variant	-	NC_000022.11:g.30942261G>A	TOPMed,gnomAD
NCI-TCGA novel	p.Pro148Ser	missense variant	-	NC_000022.11:g.30942256G>A	NCI-TCGA
rs1419852601	p.Thr149Ile	missense variant	-	NC_000022.11:g.30942252G>A	gnomAD
COSM3553454	p.Asn151Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000022.11:g.30942246T>A	NCI-TCGA Cosmic
rs1255740355	p.Ala152Gly	missense variant	-	NC_000022.11:g.30942243G>C	gnomAD
rs774502307	p.Arg153Trp	missense variant	-	NC_000022.11:g.30942241G>A	ExAC,TOPMed,gnomAD
rs768748502	p.Arg153Gln	missense variant	-	NC_000022.11:g.30942240C>T	ExAC,gnomAD
rs1290294192	p.Thr154Ile	missense variant	-	NC_000022.11:g.30942237G>A	TOPMed
rs775518683	p.Arg155Trp	missense variant	-	NC_000022.11:g.30942235G>A	ExAC,TOPMed,gnomAD
rs770383175	p.Arg155Gln	missense variant	-	NC_000022.11:g.30942234C>T	ExAC,TOPMed,gnomAD
rs746347871	p.Glu156Gln	missense variant	-	NC_000022.11:g.30942232C>G	ExAC,gnomAD
COSM3553452	p.Pro157Leu	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000022.11:g.30942228G>A	NCI-TCGA Cosmic
rs370868047	p.Pro157Arg	missense variant	-	NC_000022.11:g.30942228G>C	ESP,ExAC,TOPMed,gnomAD
rs771133022	p.Asp160Glu	missense variant	-	NC_000022.11:g.30942218G>T	ExAC,gnomAD
rs1316437948	p.Asn161His	missense variant	-	NC_000022.11:g.30942217T>G	TOPMed
NCI-TCGA novel	p.Val162Ala	missense variant	-	NC_000022.11:g.30942213A>G	NCI-TCGA
RCV000556140	p.Glu163Asp	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30942209C>A	ClinVar
rs186458188	p.Glu163Asp	missense variant	-	NC_000022.11:g.30942209C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs186458188	p.Glu163Asp	missense variant	-	NC_000022.11:g.30942209C>G	1000Genomes,ExAC,TOPMed,gnomAD
rs1382883492	p.Phe165Tyr	missense variant	-	NC_000022.11:g.30942204A>T	gnomAD
rs906292521	p.Ile167Ser	missense variant	-	NC_000022.11:g.30942198A>C	TOPMed
rs1319360253	p.Glu168Gly	missense variant	-	NC_000022.11:g.30942195T>C	gnomAD
rs1024657020	p.Thr169Arg	missense variant	-	NC_000022.11:g.30942192G>C	TOPMed,gnomAD
rs1457131129	p.Glu170Gly	missense variant	-	NC_000022.11:g.30942189T>C	gnomAD
rs144248516	p.Tyr173Ser	missense variant	-	NC_000022.11:g.30942180T>G	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Pro177Ala	missense variant	-	NC_000022.11:g.30942169G>C	NCI-TCGA
RCV000652686	p.Arg179His	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30942162C>T	ClinVar
rs541114863	p.Arg179His	missense variant	-	NC_000022.11:g.30942162C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs1368311291	p.Arg179Cys	missense variant	-	NC_000022.11:g.30942163G>A	TOPMed,gnomAD
rs1344522060	p.Thr180Ile	missense variant	-	NC_000022.11:g.30942159G>A	TOPMed
rs750265510	p.Glu181Lys	missense variant	-	NC_000022.11:g.30942157C>T	ExAC,gnomAD
rs1188036088	p.Glu181Asp	missense variant	-	NC_000022.11:g.30942155C>A	gnomAD
NCI-TCGA novel	p.Glu183Asp	missense variant	-	NC_000022.11:g.30942149T>G	NCI-TCGA
rs892112351	p.Glu183Lys	missense variant	-	NC_000022.11:g.30942151C>T	TOPMed
rs1463459057	p.Thr186Ile	missense variant	-	NC_000022.11:g.30942141G>A	gnomAD
rs1360752364	p.Phe188Ile	missense variant	-	NC_000022.11:g.30942136A>T	TOPMed
RCV000652676	p.Met189Thr	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30942132A>G	ClinVar
rs1555940315	p.Met189Thr	missense variant	-	NC_000022.11:g.30942132A>G	-
rs767362421	p.Met189Ile	missense variant	-	NC_000022.11:g.30942131C>T	ExAC,gnomAD
rs1205445337	p.Met189Val	missense variant	-	NC_000022.11:g.30942133T>C	gnomAD
COSM444879	p.Lys190Asn	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000022.11:g.30942128C>G	NCI-TCGA Cosmic
rs1246495857	p.Pro192Ser	missense variant	-	NC_000022.11:g.30942124G>A	gnomAD
rs1359737661	p.Ser195Gly	missense variant	-	NC_000022.11:g.30942115T>C	TOPMed,gnomAD
NCI-TCGA novel	p.Gly196GluPheSerTerUnk	frameshift	-	NC_000022.11:g.30942002C>-	NCI-TCGA
rs752850286	p.Val199Met	missense variant	-	NC_000022.11:g.30941994C>T	ExAC,gnomAD
rs765371898	p.Ile200Val	missense variant	-	NC_000022.11:g.30941991T>C	ExAC,TOPMed,gnomAD
rs369472062	p.Asn203Ser	missense variant	-	NC_000022.11:g.30941981T>C	ESP,ExAC,gnomAD
rs777224974	p.Met207Val	missense variant	-	NC_000022.11:g.30941970T>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Asp208Asn	missense variant	-	NC_000022.11:g.30941967C>T	NCI-TCGA
RCV000544977	p.Asn209Ser	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30941963T>C	ClinVar
rs76273991	p.Asn209Ser	missense variant	-	NC_000022.11:g.30941963T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs1049739010	p.Glu211Asp	missense variant	-	NC_000022.11:g.30941956C>G	TOPMed,gnomAD
COSM2937583	p.Ile216Thr	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000022.11:g.30941942A>G	NCI-TCGA Cosmic
rs375266158	p.Ile217Leu	missense variant	-	NC_000022.11:g.30941940T>G	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1250884654	p.Ile217Met	missense variant	-	NC_000022.11:g.30941938G>C	gnomAD
rs375266158	p.Ile217Val	missense variant	-	NC_000022.11:g.30941940T>C	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs1202548308	p.Arg221Gly	missense variant	-	NC_000022.11:g.30941928T>C	gnomAD
NCI-TCGA novel	p.Asp222Tyr	missense variant	-	NC_000022.11:g.30941925C>A	NCI-TCGA
rs748966530	p.Asp222Val	missense variant	-	NC_000022.11:g.30941924T>A	ExAC,gnomAD
NCI-TCGA novel	p.Ala226Glu	missense variant	-	NC_000022.11:g.30941912G>T	NCI-TCGA
rs1273034005	p.Glu227Asp	missense variant	-	NC_000022.11:g.30941908C>A	gnomAD
rs774960940	p.Thr228Met	missense variant	-	NC_000022.11:g.30941906G>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ser229Phe	missense variant	-	NC_000022.11:g.30941903G>A	NCI-TCGA
rs1273596532	p.Pro230Ser	missense variant	-	NC_000022.11:g.30941901G>A	gnomAD
rs768020550	p.Lys234Arg	missense variant	-	NC_000022.11:g.30941556T>C	ExAC
RCV000240855	p.Glu236Gly	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30941550T>C	ClinVar
rs1032069292	p.Glu236Gln	missense variant	-	NC_000022.11:g.30941551C>G	TOPMed,gnomAD
rs886037934	p.Glu236Gly	missense variant	-	NC_000022.11:g.30941550T>C	-
rs886037934	p.Glu236Gly	missense variant	Charcot-Marie-Tooth disease 2Z (CMT2Z)	NC_000022.11:g.30941550T>C	UniProt,dbSNP
VAR_076456	p.Glu236Gly	missense variant	Charcot-Marie-Tooth disease 2Z (CMT2Z)	NC_000022.11:g.30941550T>C	UniProt
rs1338741504	p.Arg237Gln	missense variant	-	NC_000022.11:g.30941547C>T	gnomAD
rs762233089	p.Arg237Trp	missense variant	-	NC_000022.11:g.30941548G>A	ExAC,TOPMed,gnomAD
RCV000652678	p.Arg238His	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30941544C>T	ClinVar
RCV000624421	p.Arg238Cys	missense variant	Inborn genetic diseases	NC_000022.11:g.30941545G>A	ClinVar
rs371713427	p.Arg238Ser	missense variant	-	NC_000022.11:g.30941545G>T	ESP,ExAC,TOPMed,gnomAD
rs367766290	p.Arg238Leu	missense variant	-	NC_000022.11:g.30941544C>A	ESP,ExAC,TOPMed,gnomAD
rs367766290	p.Arg238His	missense variant	-	NC_000022.11:g.30941544C>T	ESP,ExAC,TOPMed,gnomAD
RCV000706478	p.Arg238Cys	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30941545G>A	ClinVar
rs371713427	p.Arg238Cys	missense variant	-	NC_000022.11:g.30941545G>A	ESP,ExAC,TOPMed,gnomAD
rs1387852860	p.Ser239Leu	missense variant	-	NC_000022.11:g.30941541G>A	gnomAD
rs770361627	p.Phe240Leu	missense variant	-	NC_000022.11:g.30941537G>T	ExAC,gnomAD
rs930399394	p.Arg241His	missense variant	-	NC_000022.11:g.30941535C>T	gnomAD
rs1412806730	p.Ala242Ser	missense variant	-	NC_000022.11:g.30941533C>A	TOPMed
rs562392125	p.Tyr243Cys	missense variant	-	NC_000022.11:g.30941529T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs771884588	p.Ala245Thr	missense variant	-	NC_000022.11:g.30941524C>T	ExAC,TOPMed,gnomAD
rs1355363942	p.Tyr248Cys	missense variant	-	NC_000022.11:g.30941514T>C	UniProt,dbSNP
VAR_076457	p.Tyr248Cys	missense variant	-	NC_000022.11:g.30941514T>C	UniProt
rs1355363942	p.Tyr248Cys	missense variant	-	NC_000022.11:g.30941514T>C	TOPMed
NCI-TCGA novel	p.Asp250Asn	missense variant	-	NC_000022.11:g.30941509C>T	NCI-TCGA
RCV000202547	p.Arg252Trp	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30941503G>A	ClinVar
RCV000624201	p.Arg252Trp	missense variant	Inborn genetic diseases	NC_000022.11:g.30941503G>A	ClinVar
rs864309503	p.Arg252Trp	missense variant	-	NC_000022.11:g.30941503G>A	-
rs864309503	p.Arg252Trp	missense variant	Charcot-Marie-Tooth disease 2Z (CMT2Z)	NC_000022.11:g.30941503G>A	UniProt,dbSNP
VAR_076458	p.Arg252Trp	missense variant	Charcot-Marie-Tooth disease 2Z (CMT2Z)	NC_000022.11:g.30941503G>A	UniProt
NCI-TCGA novel	p.Met253Ile	missense variant	-	NC_000022.11:g.30941498C>T	NCI-TCGA
NCI-TCGA novel	p.Met253Ile	missense variant	-	NC_000022.11:g.30941498C>A	NCI-TCGA
rs1462125201	p.Phe256Val	missense variant	-	NC_000022.11:g.30941491A>C	gnomAD
rs368260550	p.Gly259Glu	missense variant	-	NC_000022.11:g.30941481C>T	ESP,ExAC,TOPMed,gnomAD
RCV000652675	p.Gly259Glu	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30941481C>T	ClinVar
rs755209985	p.His260Tyr	missense variant	-	NC_000022.11:g.30941479G>A	ExAC,gnomAD
rs1258894762	p.Val262Met	missense variant	-	NC_000022.11:g.30941473C>T	TOPMed
rs1064796495	p.Arg266Ser	missense variant	-	NC_000022.11:g.30941459C>G	-
RCV000479173	p.Arg266Ser	missense variant	-	NC_000022.11:g.30941459C>G	ClinVar
RCV000652688	p.Leu267Arg	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30941457A>C	ClinVar
rs1555939986	p.Leu267Arg	missense variant	-	NC_000022.11:g.30941457A>C	-
NCI-TCGA novel	p.Ser268Cys	missense variant	-	NC_000022.11:g.30941454G>C	NCI-TCGA
rs756217725	p.Ser268Phe	missense variant	-	NC_000022.11:g.30941454G>A	ExAC
rs987083509	p.Tyr272Phe	missense variant	-	NC_000022.11:g.30941442T>A	gnomAD
RCV000652684	p.Tyr272Phe	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30941442T>A	ClinVar
rs1345535484	p.Pro274Leu	missense variant	-	NC_000022.11:g.30941436G>A	gnomAD
rs1432892101	p.Pro274Ser	missense variant	-	NC_000022.11:g.30941437G>A	gnomAD
rs1235679626	p.Met276Ile	missense variant	-	NC_000022.11:g.30940834C>T	TOPMed
COSM444878	p.Tyr277Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000022.11:g.30940832T>C	NCI-TCGA Cosmic
RCV000652691	p.Thr280Met	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30940823G>A	ClinVar
rs764379949	p.Thr280Met	missense variant	-	NC_000022.11:g.30940823G>A	ExAC,TOPMed,gnomAD
rs1482880426	p.Arg283His	missense variant	-	NC_000022.11:g.30940814C>T	TOPMed,gnomAD
rs765158896	p.Arg283Cys	missense variant	-	NC_000022.11:g.30940815G>A	TOPMed
rs935186407	p.Thr286Ala	missense variant	-	NC_000022.11:g.30940806T>C	TOPMed
NCI-TCGA novel	p.Arg287His	missense variant	-	NC_000022.11:g.30940802C>T	NCI-TCGA
rs1362772722	p.Arg287Leu	missense variant	-	NC_000022.11:g.30940802C>A	TOPMed
rs370353700	p.Ala288Val	missense variant	-	NC_000022.11:g.30940799G>A	ESP,gnomAD
rs1300486034	p.Lys294Glu	missense variant	-	NC_000022.11:g.30940782T>C	gnomAD
rs760296192	p.His297Arg	missense variant	-	NC_000022.11:g.30940772T>C	ExAC,gnomAD
rs772766261	p.Val298Ile	missense variant	-	NC_000022.11:g.30940770C>T	ExAC,TOPMed,gnomAD
rs772766261	p.Val298Leu	missense variant	-	NC_000022.11:g.30940770C>G	ExAC,TOPMed,gnomAD
rs772766261	p.Val298Leu	missense variant	-	NC_000022.11:g.30940770C>A	ExAC,TOPMed,gnomAD
RCV000652694	p.Val298Leu	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30940770C>G	ClinVar
rs770948694	p.Glu303Lys	missense variant	-	NC_000022.11:g.30940039C>T	ExAC,gnomAD
rs554250414	p.Ala306Val	missense variant	-	NC_000022.11:g.30940029G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1320772373	p.Ala306Ser	missense variant	-	NC_000022.11:g.30940030C>A	gnomAD
rs772692197	p.Arg307Trp	missense variant	-	NC_000022.11:g.30940027G>A	ExAC,TOPMed,gnomAD
rs748648749	p.Arg307Gln	missense variant	-	NC_000022.11:g.30940026C>T	ExAC,gnomAD
rs1383231363	p.Ala309Thr	missense variant	-	NC_000022.11:g.30940021C>T	TOPMed,gnomAD
rs779251830	p.Glu310Gly	missense variant	-	NC_000022.11:g.30940017T>C	ExAC,gnomAD
rs1368116984	p.Ser311Gly	missense variant	-	NC_000022.11:g.30940015T>C	gnomAD
NCI-TCGA novel	p.Lys312Thr	missense variant	-	NC_000022.11:g.30940011T>G	NCI-TCGA
rs1269392743	p.Ala313Ser	missense variant	-	NC_000022.11:g.30940009C>A	TOPMed
rs369654856	p.Arg314Gly	missense variant	-	NC_000022.11:g.30940006G>C	ESP,ExAC,TOPMed,gnomAD
rs369654856	p.Arg314Trp	missense variant	-	NC_000022.11:g.30940006G>A	ESP,ExAC,TOPMed,gnomAD
rs751140985	p.Arg314Gln	missense variant	-	NC_000022.11:g.30940005C>T	ExAC,TOPMed,gnomAD
rs763511089	p.Thr315Ile	missense variant	-	NC_000022.11:g.30940002G>A	ExAC,gnomAD
rs1205535409	p.Leu316Ser	missense variant	-	NC_000022.11:g.30939999A>G	gnomAD
rs1428608028	p.Glu317Gln	missense variant	-	NC_000022.11:g.30939997C>G	TOPMed
rs1163530787	p.Arg319His	missense variant	-	NC_000022.11:g.30939990C>T	TOPMed
rs752625837	p.Arg319Cys	missense variant	-	NC_000022.11:g.30939991G>A	ExAC,gnomAD
RCV000664212	p.Arg319His	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30939990C>T	ClinVar
RCV000536375	p.Asp323Glu	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30939977G>T	ClinVar
rs199973357	p.Asp323Glu	missense variant	-	NC_000022.11:g.30939977G>T	ESP,ExAC,TOPMed,gnomAD
rs771231575	p.Thr325Met	missense variant	-	NC_000022.11:g.30939972G>A	ExAC,TOPMed,gnomAD
rs771231575	p.Thr325Lys	missense variant	-	NC_000022.11:g.30939972G>T	ExAC,TOPMed,gnomAD
RCV000550833	p.Arg326Trp	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30939970G>A	ClinVar
rs558057376	p.Arg326Trp	missense variant	-	NC_000022.11:g.30939970G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1383136576	p.Ser328Phe	missense variant	-	NC_000022.11:g.30939963G>A	gnomAD
rs1390155636	p.Val330Leu	missense variant	-	NC_000022.11:g.30939706C>A	gnomAD
rs746698035	p.Arg333Ter	stop gained	-	NC_000022.11:g.30939697G>A	ExAC,gnomAD
rs777252717	p.Gln334Glu	missense variant	-	NC_000022.11:g.30939694G>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ala339Ser	missense variant	-	NC_000022.11:g.30939679C>A	NCI-TCGA
rs758093788	p.Ala339Thr	missense variant	-	NC_000022.11:g.30939679C>T	ExAC,gnomAD
rs747708903	p.Thr341Ala	missense variant	-	NC_000022.11:g.30939673T>C	ExAC,gnomAD
rs778551880	p.Leu342Arg	missense variant	-	NC_000022.11:g.30939669A>C	ExAC,gnomAD
rs368475981	p.Arg343Cys	missense variant	-	NC_000022.11:g.30939667G>A	ESP,ExAC,TOPMed,gnomAD
rs753651729	p.Arg343Leu	missense variant	-	NC_000022.11:g.30939666C>A	ExAC,TOPMed,gnomAD
rs753651729	p.Arg343His	missense variant	-	NC_000022.11:g.30939666C>T	ExAC,TOPMed,gnomAD
RCV000524780	p.Arg343His	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30939666C>T	ClinVar
rs755812939	p.Arg344Lys	missense variant	-	NC_000022.11:g.30939663C>T	ExAC,gnomAD
rs750686775	p.Glu345Lys	missense variant	-	NC_000022.11:g.30939661C>T	ExAC,gnomAD
rs767764185	p.Ala346Val	missense variant	-	NC_000022.11:g.30939657G>A	ExAC,gnomAD
rs138994326	p.Asp347Asn	missense variant	-	NC_000022.11:g.30939655C>T	ESP,ExAC,gnomAD
rs1232906681	p.Val348Phe	missense variant	-	NC_000022.11:g.30939652C>A	gnomAD
rs1376305551	p.Lys350Arg	missense variant	-	NC_000022.11:g.30939645T>C	gnomAD
rs763533156	p.Arg351Trp	missense variant	-	NC_000022.11:g.30939643T>A	ExAC,gnomAD
rs775812123	p.Lys356Arg	missense variant	-	NC_000022.11:g.30939627T>C	ExAC,gnomAD
rs1198727868	p.Arg358Ter	stop gained	-	NC_000022.11:g.30939622G>A	gnomAD
rs200173132	p.Arg358Gln	missense variant	-	NC_000022.11:g.30939621C>T	ExAC,gnomAD
NCI-TCGA novel	p.Ala359Thr	missense variant	-	NC_000022.11:g.30938204C>T	NCI-TCGA
RCV000686746	p.Leu360Phe	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30938201G>A	ClinVar
rs1268129848	p.Leu360Phe	missense variant	-	NC_000022.11:g.30938201G>A	gnomAD
COSM1033341	p.Glu362Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000022.11:g.30938195C>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Pro363Ser	missense variant	-	NC_000022.11:g.30938192G>A	NCI-TCGA
NCI-TCGA novel	p.Glu365Ter	stop gained	-	NC_000022.11:g.30938186C>A	NCI-TCGA
rs764182125	p.Val369Ala	missense variant	-	NC_000022.11:g.30938173A>G	ExAC,gnomAD
rs897821512	p.Val372Phe	missense variant	-	NC_000022.11:g.30938165C>A	TOPMed
rs762901266	p.Asn373Ser	missense variant	-	NC_000022.11:g.30938161T>C	ExAC,TOPMed,gnomAD
rs1366873443	p.Ile374Thr	missense variant	-	NC_000022.11:g.30938158A>G	gnomAD
RCV000762066	p.His376Gln	missense variant	-	NC_000022.11:g.30938151G>T	ClinVar
rs1424834448	p.His376Gln	missense variant	-	NC_000022.11:g.30938151G>T	gnomAD
rs1313283174	p.Arg377Gln	missense variant	-	NC_000022.11:g.30938149C>T	TOPMed
NCI-TCGA novel	p.Ile384Met	missense variant	-	NC_000022.11:g.30938127G>C	NCI-TCGA
rs1400428370	p.Ser388Ile	missense variant	-	NC_000022.11:g.30938116C>A	gnomAD
rs1260621137	p.Arg389Gln	missense variant	-	NC_000022.11:g.30938113C>T	TOPMed
NCI-TCGA novel	p.Ile391Met	missense variant	-	NC_000022.11:g.30938106G>C	NCI-TCGA
NCI-TCGA novel	p.Ile391Ser	missense variant	-	NC_000022.11:g.30938107A>C	NCI-TCGA
RCV000498431	p.Tyr394Cys	missense variant	-	NC_000022.11:g.30938098T>C	ClinVar
rs1555938796	p.Tyr394Cys	missense variant	-	NC_000022.11:g.30938098T>C	-
rs1268869835	p.Gly404Arg	missense variant	-	NC_000022.11:g.30938069C>G	TOPMed
rs1489926879	p.Met405Val	missense variant	-	NC_000022.11:g.30938066T>C	gnomAD
NCI-TCGA novel	p.Ala406Val	missense variant	-	NC_000022.11:g.30937967G>A	NCI-TCGA
RCV000656229	p.Cys407Phe	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30937964C>A	ClinVar
rs1555938741	p.Cys407Phe	missense variant	-	NC_000022.11:g.30937964C>A	-
rs1325489365	p.Gly409Arg	missense variant	-	NC_000022.11:g.30937959C>T	gnomAD
rs766871664	p.Val410Gly	missense variant	-	NC_000022.11:g.30937955A>C	ExAC,gnomAD
rs773676225	p.Val413Gly	missense variant	-	NC_000022.11:g.30937946A>C	ExAC,gnomAD
NCI-TCGA novel	p.Pro423Ser	missense variant	-	NC_000022.11:g.30937917G>A	NCI-TCGA
VAR_081260	p.Thr424Arg	Missense	-	-	UniProt
NCI-TCGA novel	p.Ala433Ser	missense variant	-	NC_000022.11:g.30937887C>A	NCI-TCGA
rs1370510062	p.Ala433Gly	missense variant	-	NC_000022.11:g.30937886G>C	TOPMed,gnomAD
COSM3553448	p.Tyr436Cys	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000022.11:g.30937877T>C	NCI-TCGA Cosmic
NCI-TCGA novel	p.Arg437Gln	missense variant	-	NC_000022.11:g.30937874C>T	NCI-TCGA
rs1265201907	p.Leu440Val	missense variant	-	NC_000022.11:g.30937866G>C	TOPMed
rs1401669660	p.Arg441Ter	stop gained	-	NC_000022.11:g.30937863G>A	gnomAD
rs1468553790	p.Met443Ile	missense variant	-	NC_000022.11:g.30937855C>T	gnomAD
VAR_076460	p.Gly444Arg	Missense	Charcot-Marie-Tooth disease 2Z (CMT2Z) [MIM:616688]	-	UniProt
rs958295807	p.Ala448Val	missense variant	-	NC_000022.11:g.30937841G>A	TOPMed
NCI-TCGA novel	p.Trp451Cys	missense variant	-	NC_000022.11:g.30937831C>G	NCI-TCGA
rs770823800	p.Lys452Arg	missense variant	-	NC_000022.11:g.30937829T>C	ExAC,gnomAD
rs1007541711	p.Asp453Asn	missense variant	-	NC_000022.11:g.30937827C>T	TOPMed,gnomAD
rs1462459493	p.Ile454Thr	missense variant	-	NC_000022.11:g.30937823A>G	TOPMed,gnomAD
rs746856419	p.Ile454Val	missense variant	-	NC_000022.11:g.30937824T>C	ExAC,gnomAD
rs1256419099	p.Ala455Asp	missense variant	-	NC_000022.11:g.30937820G>T	gnomAD
rs1314795197	p.Ile456Ser	missense variant	-	NC_000022.11:g.30937817A>C	gnomAD
rs1237819801	p.Ile456Phe	missense variant	-	NC_000022.11:g.30937818T>A	TOPMed,gnomAD
rs1237819801	p.Ile456Val	missense variant	-	NC_000022.11:g.30937818T>C	TOPMed,gnomAD
rs1240259176	p.Ala457Thr	missense variant	-	NC_000022.11:g.30937815C>T	gnomAD
rs769617472	p.Arg459Lys	missense variant	-	NC_000022.11:g.30937705C>T	TOPMed
RCV000694058	p.Gly460Glu	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30937702C>T	ClinVar
NCI-TCGA novel	p.Ile461AsnPheSerTerUnk	frameshift	-	NC_000022.11:g.30937701_30937702insC	NCI-TCGA
VAR_076461	p.Asp466His	Missense	-	-	UniProt
COSM4931687	p.Ser472Pro	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000022.11:g.30937667A>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Asn474His	missense variant	-	NC_000022.11:g.30937661T>G	NCI-TCGA
rs772885530	p.Asn476Ser	missense variant	-	NC_000022.11:g.30937654T>C	ExAC,gnomAD
rs1426394911	p.Pro479Leu	missense variant	-	NC_000022.11:g.30937645G>A	gnomAD
rs779155513	p.Ser481Ile	missense variant	-	NC_000022.11:g.30937639C>A	ExAC,gnomAD
NCI-TCGA novel	p.Glu482Ter	stop gained	-	NC_000022.11:g.30937637C>A	NCI-TCGA
rs755216417	p.Arg484Cys	missense variant	-	NC_000022.11:g.30937631G>A	ExAC,gnomAD
rs143046507	p.Arg484His	missense variant	-	NC_000022.11:g.30937630C>T	ESP,ExAC,TOPMed,gnomAD
rs780264849	p.Arg487Cys	missense variant	-	NC_000022.11:g.30937622G>A	ExAC,TOPMed,gnomAD
rs756749223	p.Arg487His	missense variant	-	NC_000022.11:g.30937621C>T	ExAC,gnomAD
rs1356503784	p.Arg488Trp	missense variant	-	NC_000022.11:g.30937619G>A	gnomAD
rs750886983	p.Arg488Gln	missense variant	-	NC_000022.11:g.30937618C>T	ExAC,gnomAD
RCV000687756	p.Ala490Thr	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30937613C>T	ClinVar
rs1325022440	p.Met491Ile	missense variant	-	NC_000022.11:g.30937608C>T	gnomAD
rs767798376	p.Met491Val	missense variant	-	NC_000022.11:g.30937610T>C	ExAC,gnomAD
rs1280514766	p.Glu492Gly	missense variant	-	NC_000022.11:g.30937606T>C	gnomAD
rs1365491718	p.Thr495Ile	missense variant	-	NC_000022.11:g.30937597G>A	TOPMed
rs928480423	p.Thr496Ser	missense variant	-	NC_000022.11:g.30937595T>A	TOPMed
rs201852637	p.Asp500Asn	missense variant	-	NC_000022.11:g.30937583C>T	-
rs775818503	p.Leu501Val	missense variant	-	NC_000022.11:g.30937035A>C	ExAC
NCI-TCGA novel	p.Cys502Ter	stop gained	-	NC_000022.11:g.30937030_30937031insGGCCCCAACAAGTCCGTT	NCI-TCGA
COSM1033340	p.Arg506Ile	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000022.11:g.30937019C>A	NCI-TCGA Cosmic
NCI-TCGA novel	p.Gln511Glu	missense variant	-	NC_000022.11:g.30937005G>C	NCI-TCGA
NCI-TCGA novel	p.Gln511Arg	missense variant	-	NC_000022.11:g.30937004T>C	NCI-TCGA
rs1173395818	p.Gln511Ter	stop gained	-	NC_000022.11:g.30937005G>A	TOPMed
COSM3553440	p.Leu512Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000022.11:g.30937001A>T	NCI-TCGA Cosmic
rs781119754	p.Ser513Asn	missense variant	-	NC_000022.11:g.30936998C>T	ExAC,gnomAD
rs1419132371	p.Ser514Thr	missense variant	-	NC_000022.11:g.30936996A>T	TOPMed
rs1407971807	p.Ser514Cys	missense variant	-	NC_000022.11:g.30936995G>C	TOPMed
rs1555938391	p.Pro520Ser	missense variant	-	NC_000022.11:g.30936978G>A	-
rs771536089	p.Pro520Arg	missense variant	-	NC_000022.11:g.30936977G>C	ExAC,gnomAD
RCV000652677	p.Pro520Ser	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30936978G>A	ClinVar
rs749364295	p.Asp521Tyr	missense variant	-	NC_000022.11:g.30936975C>A	ExAC,TOPMed,gnomAD
rs778121452	p.Thr522Ile	missense variant	-	NC_000022.11:g.30936971G>A	ExAC,gnomAD
NCI-TCGA novel	p.Trp523Cys	missense variant	-	NC_000022.11:g.30936967C>A	NCI-TCGA
rs753519224	p.Pro529Ser	missense variant	-	NC_000022.11:g.30936951G>A	ExAC,gnomAD
rs368467051	p.Pro531Arg	missense variant	-	NC_000022.11:g.30936944G>C	ESP,ExAC,TOPMed,gnomAD
rs368467051	p.Pro531Leu	missense variant	-	NC_000022.11:g.30936944G>A	ESP,ExAC,TOPMed,gnomAD
rs576981610	p.Arg535Trp	missense variant	-	NC_000022.11:g.30936933G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs750003469	p.Arg535Gln	missense variant	-	NC_000022.11:g.30936932C>T	ExAC,gnomAD
COSM1308071	p.Glu537Gln	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000022.11:g.30936639C>G	NCI-TCGA Cosmic
NCI-TCGA novel	p.Lys542Glu	missense variant	-	NC_000022.11:g.30936624T>C	NCI-TCGA
rs971787077	p.Gln543Glu	missense variant	-	NC_000022.11:g.30936621G>C	TOPMed
COSM4466755	p.Pro546Ser	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000022.11:g.30936612G>A	NCI-TCGA Cosmic
rs1320542815	p.Leu547Met	missense variant	-	NC_000022.11:g.30936609G>T	gnomAD
rs1338480863	p.Phe550Leu	missense variant	-	NC_000022.11:g.30936598G>C	TOPMed,gnomAD
rs1228858484	p.Phe550Leu	missense variant	-	NC_000022.11:g.30936600A>G	gnomAD
NCI-TCGA novel	p.Arg551Lys	missense variant	-	NC_000022.11:g.30936596C>T	NCI-TCGA
NCI-TCGA novel	p.Met554Ile	missense variant	-	NC_000022.11:g.30936586C>T	NCI-TCGA
rs776665575	p.Thr556Met	missense variant	-	NC_000022.11:g.30936581G>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gln557Arg	missense variant	-	NC_000022.11:g.30936578T>C	NCI-TCGA
NCI-TCGA novel	p.Gln561His	missense variant	-	NC_000022.11:g.30936565C>A	NCI-TCGA
rs773249903	p.Gln563His	missense variant	-	NC_000022.11:g.30936559T>A	ExAC,gnomAD
NCI-TCGA novel	p.Thr565Ala	missense variant	-	NC_000022.11:g.30936555T>C	NCI-TCGA
rs1467916987	p.Thr565Ile	missense variant	-	NC_000022.11:g.30936554G>A	TOPMed
rs1467916987	p.Thr565Lys	missense variant	-	NC_000022.11:g.30936554G>T	TOPMed
rs748648883	p.Lys567Arg	missense variant	-	NC_000022.11:g.30936548T>C	ExAC,gnomAD
RCV000497343	p.Arg569Cys	missense variant	-	NC_000022.11:g.30936543G>A	ClinVar
rs149057277	p.Arg569His	missense variant	-	NC_000022.11:g.30936542C>T	ESP,ExAC,gnomAD
rs267606222	p.Arg569Cys	missense variant	-	NC_000022.11:g.30936543G>A	ExAC,gnomAD
rs149057277	p.Arg569Leu	missense variant	-	NC_000022.11:g.30936542C>A	ESP,ExAC,gnomAD
rs780749674	p.Glu573Lys	missense variant	-	NC_000022.11:g.30936531C>T	ExAC,gnomAD
rs756912389	p.Ala577Ser	missense variant	-	NC_000022.11:g.30936519C>A	ExAC,gnomAD
COSM3553438	p.Gln579Ter	stop gained	Variant assessed as Somatic; HIGH impact.	NC_000022.11:g.30936513G>A	NCI-TCGA Cosmic
rs1199054962	p.Gln579Arg	missense variant	-	NC_000022.11:g.30936512T>C	gnomAD
rs770774096	p.Pro583Thr	missense variant	-	NC_000022.11:g.30935313G>T	ExAC,gnomAD
rs137983239	p.Arg585His	missense variant	-	NC_000022.11:g.30935306C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs548292999	p.Arg585Cys	missense variant	-	NC_000022.11:g.30935307G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs146972491	p.Leu590Val	missense variant	-	NC_000022.11:g.30935292G>C	ESP,ExAC,TOPMed,gnomAD
rs779894782	p.Leu590Arg	missense variant	-	NC_000022.11:g.30935291A>C	ExAC,gnomAD
rs767604848	p.Thr598Ile	missense variant	-	NC_000022.11:g.30935267G>A	ExAC,gnomAD
rs200774292	p.Arg600Lys	missense variant	-	NC_000022.11:g.30935261C>T	ESP,ExAC,TOPMed,gnomAD
rs764568031	p.Pro601His	missense variant	-	NC_000022.11:g.30935258G>T	ExAC,TOPMed,gnomAD
rs764568031	p.Pro601Arg	missense variant	-	NC_000022.11:g.30935258G>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ser602Phe	missense variant	-	NC_000022.11:g.30935255G>A	NCI-TCGA
rs779836770	p.Pro606Thr	missense variant	-	NC_000022.11:g.30935158G>T	ExAC,TOPMed,gnomAD
rs779836770	p.Pro606Ser	missense variant	-	NC_000022.11:g.30935158G>A	ExAC,TOPMed,gnomAD
rs141345937	p.Val607Leu	missense variant	-	NC_000022.11:g.30935155C>A	ESP,TOPMed,gnomAD
rs1555937777	p.Val607Ala	missense variant	-	NC_000022.11:g.30935154A>G	-
RCV000652690	p.Val607Ala	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30935154A>G	ClinVar
rs781443418	p.Arg608His	missense variant	-	NC_000022.11:g.30935151C>T	ExAC,TOPMed,gnomAD
rs373963382	p.Arg608Cys	missense variant	-	NC_000022.11:g.30935152G>A	ESP,ExAC,TOPMed,gnomAD
rs373963382	p.Arg608Gly	missense variant	-	NC_000022.11:g.30935152G>C	ESP,ExAC,TOPMed,gnomAD
rs757458854	p.Arg609Thr	missense variant	-	NC_000022.11:g.30935148C>G	ExAC,gnomAD
rs751657222	p.Gln611Arg	missense variant	-	NC_000022.11:g.30935142T>C	ExAC,gnomAD
rs763388376	p.Arg612His	missense variant	-	NC_000022.11:g.30935139C>T	ExAC,gnomAD
rs764168751	p.Arg612Cys	missense variant	-	NC_000022.11:g.30935140G>A	ExAC,gnomAD
NCI-TCGA novel	p.Pro613Ser	missense variant	-	NC_000022.11:g.30935137G>A	NCI-TCGA
rs753203218	p.Arg614Trp	missense variant	-	NC_000022.11:g.30935134G>A	ExAC,gnomAD
rs1399556111	p.Arg614Gln	missense variant	-	NC_000022.11:g.30935133C>T	gnomAD
rs760016835	p.Pro617His	missense variant	-	NC_000022.11:g.30935124G>T	ExAC,gnomAD
rs777110123	p.Pro619Ser	missense variant	-	NC_000022.11:g.30935119G>A	ExAC,gnomAD
rs1459400105	p.Ala620Thr	missense variant	-	NC_000022.11:g.30935116C>T	gnomAD
RCV000699209	p.Val621Ter	frameshift	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30935115dup	ClinVar
rs1469187350	p.Val621Met	missense variant	-	NC_000022.11:g.30935113C>T	TOPMed
NCI-TCGA novel	p.Ile622Thr	missense variant	-	NC_000022.11:g.30935109A>G	NCI-TCGA
rs936078755	p.Ile622Val	missense variant	-	NC_000022.11:g.30935110T>C	TOPMed
rs761518693	p.Asn624Ser	missense variant	-	NC_000022.11:g.30935103T>C	ExAC
rs773737902	p.Ala625Gly	missense variant	-	NC_000022.11:g.30935100G>C	ExAC,gnomAD
rs1476604092	p.Ala625Thr	missense variant	-	NC_000022.11:g.30935101C>T	gnomAD
rs773737902	p.Ala625Asp	missense variant	-	NC_000022.11:g.30935100G>T	ExAC,gnomAD
rs147842214	p.Pro626His	missense variant	-	NC_000022.11:g.30935097G>T	ESP,ExAC,gnomAD
rs1267147618	p.Arg628Gly	missense variant	-	NC_000022.11:g.30935092T>C	TOPMed,gnomAD
rs769699735	p.Pro629Ala	missense variant	-	NC_000022.11:g.30935089G>C	ExAC,gnomAD
rs745722246	p.Pro629Arg	missense variant	-	NC_000022.11:g.30935088G>C	ExAC,TOPMed,gnomAD
rs745722246	p.Pro629His	missense variant	-	NC_000022.11:g.30935088G>T	ExAC,TOPMed,gnomAD
rs1218394103	p.Ser631Phe	missense variant	-	NC_000022.11:g.30935082G>A	TOPMed,gnomAD
NCI-TCGA novel	p.Leu632Met	missense variant	-	NC_000022.11:g.30935080A>T	NCI-TCGA
rs757425274	p.Thr634Ile	missense variant	-	NC_000022.11:g.30935073G>A	ExAC,gnomAD
NCI-TCGA novel	p.Pro635Arg	missense variant	-	NC_000022.11:g.30935070G>C	NCI-TCGA
NCI-TCGA novel	p.Pro635Leu	missense variant	-	NC_000022.11:g.30935070G>A	NCI-TCGA
rs1280299638	p.Pro635Ser	missense variant	-	NC_000022.11:g.30935071G>A	gnomAD
rs777740636	p.Pro637Thr	missense variant	-	NC_000022.11:g.30935065G>T	ExAC,gnomAD
rs758467225	p.Ala638Pro	missense variant	-	NC_000022.11:g.30935062C>G	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gln640His	missense variant	-	NC_000022.11:g.30935054C>G	NCI-TCGA
NCI-TCGA novel	p.Pro641LeuPheSerTerUnkUnk	frameshift	-	NC_000022.11:g.30935052_30935053insA	NCI-TCGA
rs1388377935	p.Pro641Ser	missense variant	-	NC_000022.11:g.30935053G>A	gnomAD
rs373881103	p.Arg642Ter	stop gained	-	NC_000022.11:g.30935050G>A	ESP,ExAC,TOPMed,gnomAD
rs765892287	p.Arg642Gln	missense variant	-	NC_000022.11:g.30935049C>T	ExAC,gnomAD
rs1463865042	p.Lys643Glu	missense variant	-	NC_000022.11:g.30935047T>C	gnomAD
rs755526155	p.Pro645Leu	missense variant	-	NC_000022.11:g.30935040G>A	ExAC,TOPMed,gnomAD
rs1477506756	p.Ile647Val	missense variant	-	NC_000022.11:g.30935035T>C	gnomAD
rs754318159	p.Ile647Thr	missense variant	-	NC_000022.11:g.30935034A>G	ExAC,TOPMed,gnomAD
rs200703581	p.Ser648Gly	missense variant	-	NC_000022.11:g.30935032T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs371710965	p.Thr650Ile	missense variant	-	NC_000022.11:g.30935025G>A	ESP,ExAC,TOPMed,gnomAD
RCV000652692	p.Thr650Ile	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30935025G>A	ClinVar
rs774005231	p.Lys652Arg	missense variant	-	NC_000022.11:g.30935019T>C	ExAC,gnomAD
rs763542037	p.Lys652Asn	missense variant	-	NC_000022.11:g.30935018C>G	ExAC,TOPMed,gnomAD
rs762562780	p.Pro654Leu	missense variant	-	NC_000022.11:g.30935013G>A	ExAC,gnomAD
rs774970275	p.Ala655Thr	missense variant	-	NC_000022.11:g.30935011C>T	ExAC,gnomAD
rs1025079681	p.Ala658Thr	missense variant	-	NC_000022.11:g.30935002C>T	gnomAD
rs1025079681	p.Ala658Ser	missense variant	-	NC_000022.11:g.30935002C>A	gnomAD
rs781527357	p.Arg659Trp	missense variant	-	NC_000022.11:g.30934999G>A	TOPMed,gnomAD
rs769791429	p.Arg659Gln	missense variant	-	NC_000022.11:g.30934998C>T	ExAC,gnomAD
NCI-TCGA novel	p.Glu660Lys	missense variant	-	NC_000022.11:g.30934996C>T	NCI-TCGA
rs776424321	p.Glu660Val	missense variant	-	NC_000022.11:g.30934995T>A	ExAC,gnomAD
rs776424321	p.Glu660Ala	missense variant	-	NC_000022.11:g.30934995T>G	ExAC,gnomAD
rs770714218	p.Ala662Thr	missense variant	-	NC_000022.11:g.30934990C>T	ExAC,TOPMed,gnomAD
rs1444539161	p.Ala662Asp	missense variant	-	NC_000022.11:g.30934989G>T	gnomAD
rs1402143255	p.Ser665Cys	missense variant	-	NC_000022.11:g.30934980G>C	TOPMed,gnomAD
rs1413491250	p.Arg666Ser	missense variant	-	NC_000022.11:g.30934976C>A	TOPMed,gnomAD
rs1399587798	p.Leu667Pro	missense variant	-	NC_000022.11:g.30934974A>G	gnomAD
NCI-TCGA novel	p.Leu668Phe	missense variant	-	NC_000022.11:g.30934972G>A	NCI-TCGA
rs747230744	p.Pro670Leu	missense variant	-	NC_000022.11:g.30934965G>A	ExAC,gnomAD
NCI-TCGA novel	p.Glu672Gln	missense variant	-	NC_000022.11:g.30934960C>G	NCI-TCGA
rs778099643	p.Ala673Gly	missense variant	-	NC_000022.11:g.30934956G>C	ExAC,gnomAD
rs1178513326	p.Pro674Ala	missense variant	-	NC_000022.11:g.30934954G>C	gnomAD
rs758529949	p.Pro674Leu	missense variant	-	NC_000022.11:g.30934953G>A	ExAC
rs563612262	p.Arg675Gln	missense variant	-	NC_000022.11:g.30934950C>T	1000Genomes,ExAC,gnomAD
COSM1033339	p.Leu681ArgPheSerTerUnkUnk	frameshift	Variant assessed as Somatic; HIGH impact.	NC_000022.11:g.30934931_30934932GA>-	NCI-TCGA Cosmic
RCV000558469	p.Val682Ile	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30934930C>T	ClinVar
rs144493873	p.Val682Ile	missense variant	-	NC_000022.11:g.30934930C>T	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs766675520	p.Thr684Ala	missense variant	-	NC_000022.11:g.30934924T>C	ExAC,gnomAD
NCI-TCGA novel	p.Ser686AlaPheSerTerUnkUnk	frameshift	-	NC_000022.11:g.30934896_30934918TGCACCAGAGGGGCAGGTCGGGA>-	NCI-TCGA
rs1309955820	p.Arg687Gly	missense variant	-	NC_000022.11:g.30934915G>C	gnomAD
rs201772330	p.Arg687Gln	missense variant	-	NC_000022.11:g.30934914C>T	ESP,ExAC,TOPMed,gnomAD
rs1456920538	p.Pro688Leu	missense variant	-	NC_000022.11:g.30934911G>A	TOPMed
rs560948457	p.Ala689Val	missense variant	-	NC_000022.11:g.30934908G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs752208368	p.Pro690Leu	missense variant	-	NC_000022.11:g.30934905G>A	ExAC,gnomAD
rs142307145	p.Leu691Pro	missense variant	-	NC_000022.11:g.30934902A>G	ESP,ExAC,gnomAD
rs151033664	p.Gln694His	missense variant	-	NC_000022.11:g.30934892T>G	ESP,TOPMed,gnomAD
NCI-TCGA novel	p.Ser696ThrLeu	insertion	-	NC_000022.11:g.30934886_30934887insAATGTA	NCI-TCGA
rs770746258	p.Pro697Ser	missense variant	-	NC_000022.11:g.30934885G>A	ExAC,gnomAD
rs897158764	p.Ser698Pro	missense variant	-	NC_000022.11:g.30934882A>G	TOPMed,gnomAD
RCV000652682	p.Ser698Pro	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30934882A>G	ClinVar
rs772866972	p.Leu700Pro	missense variant	-	NC_000022.11:g.30934875A>G	ExAC,gnomAD
rs201032497	p.Asn702Lys	missense variant	-	NC_000022.11:g.30934868G>T	ESP,ExAC,TOPMed,gnomAD
rs748310325	p.Ser703Ala	missense variant	-	NC_000022.11:g.30934867A>C	ExAC,gnomAD
rs1286651998	p.Lys704Arg	missense variant	-	NC_000022.11:g.30934863T>C	TOPMed,gnomAD
rs1386693989	p.Pro706Ser	missense variant	-	NC_000022.11:g.30934858G>A	gnomAD
rs768807060	p.Arg707Gln	missense variant	-	NC_000022.11:g.30934854C>T	ExAC,gnomAD
RCV000652687	p.Arg707Gln	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30934854C>T	ClinVar
rs779144529	p.Arg707Trp	missense variant	-	NC_000022.11:g.30934855G>A	ExAC,gnomAD
rs201652834	p.Glu708Asp	missense variant	-	NC_000022.11:g.30934850C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1015638849	p.Val709Ile	missense variant	-	NC_000022.11:g.30934849C>T	TOPMed,gnomAD
RCV000652679	p.Pro710Ser	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30934846G>A	ClinVar
rs780648306	p.Pro710Ser	missense variant	-	NC_000022.11:g.30934846G>A	ExAC,TOPMed,gnomAD
rs1296015586	p.Pro710Leu	missense variant	-	NC_000022.11:g.30934845G>A	gnomAD
rs1360682657	p.Pro712Leu	missense variant	-	NC_000022.11:g.30934839G>A	gnomAD
rs1401272017	p.Pro712Ser	missense variant	-	NC_000022.11:g.30934840G>A	gnomAD
rs1360682657	p.Pro712His	missense variant	-	NC_000022.11:g.30934839G>T	gnomAD
rs572065690	p.Lys713Arg	missense variant	-	NC_000022.11:g.30934836T>C	1000Genomes,ExAC,gnomAD
rs750868340	p.Lys716Arg	missense variant	-	NC_000022.11:g.30934827T>C	ExAC,gnomAD
rs781347453	p.Pro718Arg	missense variant	-	NC_000022.11:g.30934821G>C	ExAC
rs1411986814	p.Val720Leu	missense variant	-	NC_000022.11:g.30934816C>G	gnomAD
rs564766575	p.Lys721Asn	missense variant	-	NC_000022.11:g.30934811C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs892018476	p.Lys721Arg	missense variant	-	NC_000022.11:g.30934812T>C	TOPMed
rs564766575	p.Lys721Asn	missense variant	-	NC_000022.11:g.30934811C>G	1000Genomes,ExAC,TOPMed,gnomAD
rs1031845854	p.Glu724Gly	missense variant	-	NC_000022.11:g.30934803T>C	TOPMed
rs1475628051	p.Ser725Leu	missense variant	-	NC_000022.11:g.30934800G>A	gnomAD
rs1000336064	p.Pro726Leu	missense variant	-	NC_000022.11:g.30934797G>A	TOPMed
rs1189904059	p.Lys728Glu	missense variant	-	NC_000022.11:g.30934792T>C	gnomAD
rs1191862462	p.Lys728Arg	missense variant	-	NC_000022.11:g.30934791T>C	gnomAD
rs759091855	p.Ser730Thr	missense variant	-	NC_000022.11:g.30934786A>T	ExAC,gnomAD
rs766400089	p.Pro731Ser	missense variant	-	NC_000022.11:g.30934783G>A	ExAC,gnomAD
rs760522350	p.Pro731Leu	missense variant	-	NC_000022.11:g.30934782G>A	ExAC,gnomAD
RCV000658936	p.Pro731Leu	missense variant	-	NC_000022.11:g.30934782G>A	ClinVar
rs1369195279	p.Ala732Gly	missense variant	-	NC_000022.11:g.30934190G>C	gnomAD
rs1208548110	p.Thr733Ile	missense variant	-	NC_000022.11:g.30934187G>A	gnomAD
NCI-TCGA novel	p.Pro734Leu	missense variant	-	NC_000022.11:g.30934184G>A	NCI-TCGA
rs186049675	p.Ser735Gly	missense variant	-	NC_000022.11:g.30934182T>C	1000Genomes,ExAC,TOPMed,gnomAD
rs767451837	p.Arg736Trp	missense variant	-	NC_000022.11:g.30934179G>A	ExAC,TOPMed,gnomAD
rs761740534	p.Arg738Gln	missense variant	-	NC_000022.11:g.30934172C>T	ExAC,gnomAD
rs543735221	p.Val740Ile	missense variant	-	NC_000022.11:g.30934167C>T	1000Genomes
rs774264562	p.Ala741Thr	missense variant	-	NC_000022.11:g.30934164C>T	ExAC,TOPMed,gnomAD
rs774264562	p.Ala741Pro	missense variant	-	NC_000022.11:g.30934164C>G	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Ser743Phe	missense variant	-	NC_000022.11:g.30934157G>A	NCI-TCGA
rs1355314928	p.Ser743Pro	missense variant	-	NC_000022.11:g.30934158A>G	gnomAD
rs142840638	p.Ser743Tyr	missense variant	-	NC_000022.11:g.30934157G>T	ESP,ExAC,TOPMed,gnomAD
rs763203419	p.Asp744Gly	missense variant	-	NC_000022.11:g.30934154T>C	ExAC,gnomAD
NCI-TCGA novel	p.Val748CysPheSerTerUnk	frameshift	-	NC_000022.11:g.30934143_30934144insA	NCI-TCGA
rs746418433	p.Val748Ala	missense variant	-	NC_000022.11:g.30934142A>G	ExAC,TOPMed,gnomAD
rs1236088807	p.Glu750Lys	missense variant	-	NC_000022.11:g.30934137C>T	gnomAD
rs1255016937	p.Glu751Gly	missense variant	-	NC_000022.11:g.30934133T>C	gnomAD
rs777048144	p.Glu751Lys	missense variant	-	NC_000022.11:g.30934134C>T	ExAC,gnomAD
rs1207662510	p.Ala752Thr	missense variant	-	NC_000022.11:g.30934131C>T	gnomAD
rs774444542	p.Glu757Gly	missense variant	-	NC_000022.11:g.30934115T>C	ExAC,TOPMed,gnomAD
rs747434209	p.Cys759Tyr	missense variant	-	NC_000022.11:g.30934109C>T	ExAC,gnomAD
rs754626172	p.Arg761Gln	missense variant	-	NC_000022.11:g.30934103C>T	ExAC,gnomAD
RCV000547285	p.Arg761Trp	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30934104G>A	ClinVar
rs369384586	p.Arg761Trp	missense variant	-	NC_000022.11:g.30934104G>A	ESP,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Arg763Thr	missense variant	-	NC_000022.11:g.30934097C>G	NCI-TCGA
rs1393469763	p.Phe764Leu	missense variant	-	NC_000022.11:g.30934095A>G	TOPMed,gnomAD
rs1396767941	p.Phe764Leu	missense variant	-	NC_000022.11:g.30934093A>C	TOPMed,gnomAD
rs1381697088	p.Glu768Gly	missense variant	-	NC_000022.11:g.30934082T>C	gnomAD
rs924947796	p.Glu769Lys	missense variant	-	NC_000022.11:g.30934080C>T	TOPMed
rs1446108389	p.Glu769Val	missense variant	-	NC_000022.11:g.30934079T>A	gnomAD
RCV000598874	p.Lys771Ter	nonsense	-	NC_000022.11:g.30934074T>A	ClinVar
rs1555937236	p.Lys771Ter	stop gained	-	NC_000022.11:g.30934074T>A	-
rs1174370013	p.Asp772Glu	missense variant	-	NC_000022.11:g.30934069G>T	gnomAD
rs554785074	p.Ser773Leu	missense variant	-	NC_000022.11:g.30934067G>A	1000Genomes,ExAC,gnomAD
rs1418966449	p.Ser773Thr	missense variant	-	NC_000022.11:g.30934068A>T	gnomAD
rs1486497006	p.Leu776Phe	missense variant	-	NC_000022.11:g.30933520G>A	TOPMed,gnomAD
rs1022082270	p.Ser779Arg	missense variant	-	NC_000022.11:g.30933511T>G	TOPMed,gnomAD
rs757275863	p.Ser779Asn	missense variant	-	NC_000022.11:g.30933510C>T	ExAC,gnomAD
rs1022082270	p.Ser779Gly	missense variant	-	NC_000022.11:g.30933511T>C	TOPMed,gnomAD
rs1337452928	p.Glu783Ter	stop gained	-	NC_000022.11:g.30933499C>A	gnomAD
rs1294128558	p.Asp784Gly	missense variant	-	NC_000022.11:g.30933495T>C	gnomAD
rs551185965	p.Ser785Leu	missense variant	-	NC_000022.11:g.30933492G>A	1000Genomes,ExAC,TOPMed,gnomAD
rs752518393	p.Ala786Thr	missense variant	-	NC_000022.11:g.30933490C>T	ExAC,gnomAD
rs765437788	p.Ala786Gly	missense variant	-	NC_000022.11:g.30933489G>C	ExAC,gnomAD
rs766384151	p.Asp787Glu	missense variant	-	NC_000022.11:g.30933485G>T	ExAC,TOPMed,gnomAD
rs773667183	p.Lys789Glu	missense variant	-	NC_000022.11:g.30933481T>C	ExAC,TOPMed,gnomAD
rs1217262379	p.Lys789Arg	missense variant	-	NC_000022.11:g.30933480T>C	TOPMed
NCI-TCGA novel	p.Arg790Ile	missense variant	-	NC_000022.11:g.30933477C>A	NCI-TCGA
rs772600152	p.Ala791Val	missense variant	-	NC_000022.11:g.30933474G>A	ExAC,gnomAD
rs772600152	p.Ala791Gly	missense variant	-	NC_000022.11:g.30933474G>C	ExAC,gnomAD
rs1425097407	p.Lys793Gln	missense variant	-	NC_000022.11:g.30933469T>G	gnomAD
rs1259713033	p.Leu797Gln	missense variant	-	NC_000022.11:g.30933021A>T	TOPMed
rs1236354994	p.His798Arg	missense variant	-	NC_000022.11:g.30933018T>C	gnomAD
rs1254339344	p.His798Tyr	missense variant	-	NC_000022.11:g.30933019G>A	gnomAD
rs370149816	p.Val799Met	missense variant	-	NC_000022.11:g.30933016C>T	ESP,ExAC,gnomAD
rs1489333271	p.Val801Met	missense variant	-	NC_000022.11:g.30933010C>T	TOPMed
COSM184850	p.Arg802His	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000022.11:g.30933006C>T	NCI-TCGA Cosmic
rs759734334	p.Asn804Ser	missense variant	-	NC_000022.11:g.30933000T>C	TOPMed
rs554086969	p.Trp807Ter	stop gained	-	NC_000022.11:g.30932990C>T	1000Genomes,ExAC,gnomAD
rs767566826	p.Arg811Ser	missense variant	-	NC_000022.11:g.30932980G>T	ExAC,gnomAD
rs1163301326	p.Arg811His	missense variant	-	NC_000022.11:g.30932979C>T	TOPMed,gnomAD
NCI-TCGA novel	p.Ala814Ser	missense variant	-	NC_000022.11:g.30932971C>A	NCI-TCGA
COSM1415749	p.Ala814Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000022.11:g.30932970G>A	NCI-TCGA Cosmic
rs1396182121	p.Val815Met	missense variant	-	NC_000022.11:g.30932968C>T	gnomAD
rs1158644986	p.Glu816Lys	missense variant	-	NC_000022.11:g.30932965C>T	gnomAD
rs752066714	p.Val817Leu	missense variant	-	NC_000022.11:g.30932962C>A	ExAC,gnomAD
NCI-TCGA novel	p.Lys819Asn	missense variant	-	NC_000022.11:g.30932954C>A	NCI-TCGA
rs764479914	p.Arg823Gln	missense variant	-	NC_000022.11:g.30932943C>T	ExAC,gnomAD
rs1452993249	p.Val831Met	missense variant	-	NC_000022.11:g.30932920C>T	TOPMed
rs1486061047	p.Thr833Ala	missense variant	-	NC_000022.11:g.30932914T>C	gnomAD
rs1287094385	p.Asp834Gly	missense variant	-	NC_000022.11:g.30932910T>C	TOPMed
COSM3553426	p.Thr835Arg	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000022.11:g.30932907G>C	NCI-TCGA Cosmic
rs760341830	p.Thr835Met	missense variant	-	NC_000022.11:g.30932907G>A	ExAC,gnomAD
NCI-TCGA novel	p.Arg838Ter	stop gained	-	NC_000022.11:g.30932899T>A	NCI-TCGA
NCI-TCGA novel	p.Arg840His	missense variant	-	NC_000022.11:g.30932892C>T	NCI-TCGA
rs771558349	p.Arg840Gly	missense variant	-	NC_000022.11:g.30932893G>C	ExAC,gnomAD
rs954359222	p.Val842Leu	missense variant	-	NC_000022.11:g.30932768C>A	TOPMed
rs1319601548	p.Gly845Asp	missense variant	-	NC_000022.11:g.30932758C>T	gnomAD
rs1405133799	p.Ser846Arg	missense variant	-	NC_000022.11:g.30932756T>G	gnomAD
rs1167291928	p.Asp848Glu	missense variant	-	NC_000022.11:g.30932748A>T	gnomAD
rs1380344040	p.Asp848Asn	missense variant	-	NC_000022.11:g.30932750C>T	TOPMed
rs775277249	p.Asp848Ala	missense variant	-	NC_000022.11:g.30932749T>G	ExAC,TOPMed,gnomAD
rs373048769	p.Arg850Trp	missense variant	-	NC_000022.11:g.30932744G>A	ESP,ExAC,TOPMed,gnomAD
rs1184836129	p.Pro854Ser	missense variant	-	NC_000022.11:g.30932732G>A	gnomAD
NCI-TCGA novel	p.Pro855LeuPheSerTerUnkUnk	frameshift	-	NC_000022.11:g.30932728G>-	NCI-TCGA
rs369585779	p.Pro855Ser	missense variant	-	NC_000022.11:g.30932729G>A	ESP,ExAC,TOPMed,gnomAD
rs1232833094	p.Pro855Leu	missense variant	-	NC_000022.11:g.30932728G>A	gnomAD
rs1345884860	p.Pro857Leu	missense variant	-	NC_000022.11:g.30932722G>A	TOPMed
rs1279734763	p.Pro857Ala	missense variant	-	NC_000022.11:g.30932723G>C	TOPMed
rs1212477212	p.Glu858Asp	missense variant	-	NC_000022.11:g.30932718T>A	TOPMed
rs1198148351	p.Glu858Lys	missense variant	-	NC_000022.11:g.30932720C>T	gnomAD
rs1555936598	p.LeuAspThrGlnGlnGluGly862LeuAspThrGlnGlnGluGlyTerTyrThrThrGlyGlyUnk	stop gained	-	NC_000022.11:g.30932689_30932707dup	-
NCI-TCGA novel	p.Asp863His	missense variant	-	NC_000022.11:g.30932705C>G	NCI-TCGA
rs1274820228	p.Asp863Glu	missense variant	-	NC_000022.11:g.30932703A>T	gnomAD
rs1480181047	p.Gln865Arg	missense variant	-	NC_000022.11:g.30932698T>C	TOPMed
RCV000623450	p.Gly869Ter	nonsense	Inborn genetic diseases	NC_000022.11:g.30932689_30932707dup	ClinVar
rs143046823	p.Gly869Arg	missense variant	-	NC_000022.11:g.30932687C>T	ESP,ExAC,TOPMed,gnomAD
rs375217252	p.Glu870Asp	missense variant	-	NC_000022.11:g.30932682C>G	ESP,TOPMed,gnomAD
rs1255812110	p.Glu870Gln	missense variant	-	NC_000022.11:g.30932684C>G	gnomAD
rs753210391	p.Glu872Gln	missense variant	-	NC_000022.11:g.30932678C>G	ExAC,TOPMed,gnomAD
rs138350528	p.Val873Leu	missense variant	-	NC_000022.11:g.30932675C>A	ExAC,TOPMed,gnomAD
rs138350528	p.Val873Leu	missense variant	-	NC_000022.11:g.30932675C>G	ExAC,TOPMed,gnomAD
rs754127740	p.Pro875Ala	missense variant	-	NC_000022.11:g.30932669G>C	ExAC,gnomAD
RCV000652693	p.Gln878His	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30932658C>G	ClinVar
rs1388475410	p.Gln878His	missense variant	-	NC_000022.11:g.30932658C>G	TOPMed,gnomAD
rs767254485	p.Gln878Leu	missense variant	-	NC_000022.11:g.30932659T>A	ExAC,TOPMed,gnomAD
rs1399798893	p.Gln879Glu	missense variant	-	NC_000022.11:g.30932657G>C	gnomAD
rs761366027	p.Ile881Thr	missense variant	-	NC_000022.11:g.30932650A>G	ExAC,gnomAD
rs1379697348	p.Ile881Met	missense variant	-	NC_000022.11:g.30932649T>C	TOPMed
rs762899928	p.Ala882Val	missense variant	-	NC_000022.11:g.30932647G>A	ExAC,gnomAD
rs372199572	p.Ala882Thr	missense variant	-	NC_000022.11:g.30932648C>T	ESP,ExAC,TOPMed,gnomAD
rs372199572	p.Ala882Pro	missense variant	-	NC_000022.11:g.30932648C>G	ESP,ExAC,TOPMed,gnomAD
rs775447036	p.Val883Ile	missense variant	-	NC_000022.11:g.30932645C>T	ExAC,gnomAD
rs372297066	p.Ala884Thr	missense variant	-	NC_000022.11:g.30932642C>T	ExAC,TOPMed,gnomAD
rs1194004265	p.Glu885Gln	missense variant	-	NC_000022.11:g.30932639C>G	TOPMed,gnomAD
rs776286972	p.Glu885Gly	missense variant	-	NC_000022.11:g.30932638T>C	ExAC,TOPMed,gnomAD
COSM3553424	p.Ser887Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000022.11:g.30932632G>A	NCI-TCGA Cosmic
rs771192309	p.Ser887Tyr	missense variant	-	NC_000022.11:g.30932632G>T	ExAC,gnomAD
NCI-TCGA novel	p.Ser889Ala	missense variant	-	NC_000022.11:g.30932627A>C	NCI-TCGA
rs747144945	p.Ser889Cys	missense variant	-	NC_000022.11:g.30932626G>C	ExAC,gnomAD
rs201090445	p.Glu890Lys	missense variant	-	NC_000022.11:g.30932624C>T	1000Genomes,ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Cys891Tyr	missense variant	-	NC_000022.11:g.30932620C>T	NCI-TCGA
rs748203997	p.Leu892Phe	missense variant	-	NC_000022.11:g.30932618G>A	ExAC,gnomAD
rs202243108	p.Arg893His	missense variant	-	NC_000022.11:g.30932614C>T	1000Genomes,ExAC,TOPMed,gnomAD
rs150496681	p.Arg893Cys	missense variant	-	NC_000022.11:g.30932615G>A	1000Genomes,ESP,ExAC,TOPMed,gnomAD
rs202243108	p.Arg893Leu	missense variant	-	NC_000022.11:g.30932614C>A	1000Genomes,ExAC,TOPMed,gnomAD
rs1376706321	p.Ile894Val	missense variant	-	NC_000022.11:g.30932612T>C	gnomAD
rs371685129	p.Glu895Asp	missense variant	-	NC_000022.11:g.30932607C>G	ESP,ExAC,TOPMed,gnomAD
rs756946772	p.Pro896Arg	missense variant	-	NC_000022.11:g.30932605G>C	ExAC,gnomAD
NCI-TCGA novel	p.Ala900Val	missense variant	-	NC_000022.11:g.30932593G>A	NCI-TCGA
rs1555936530	p.Ala900Ser	missense variant	-	NC_000022.11:g.30932594C>A	-
RCV000534380	p.Ala900Ser	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30932594C>A	ClinVar
rs751164695	p.Leu901Pro	missense variant	-	NC_000022.11:g.30932590A>G	ExAC,gnomAD
rs1432991533	p.Ser902Gly	missense variant	-	NC_000022.11:g.30932588T>C	gnomAD
rs141633101	p.Ser902Thr	missense variant	-	NC_000022.11:g.30932587C>G	ESP,ExAC,TOPMed
rs762499940	p.Thr903Ser	missense variant	-	NC_000022.11:g.30932584G>C	ExAC,TOPMed,gnomAD
rs1042426757	p.Asn904Ser	missense variant	-	NC_000022.11:g.30932581T>C	TOPMed,gnomAD
rs1402877477	p.His905Tyr	missense variant	-	NC_000022.11:g.30932579G>A	TOPMed
rs759328437	p.Glu906Lys	missense variant	-	NC_000022.11:g.30932576C>T	ExAC,gnomAD
rs770586964	p.Asp909Asn	missense variant	-	NC_000022.11:g.30932567C>T	ExAC,gnomAD
rs374410153	p.Leu910Met	missense variant	-	NC_000022.11:g.30932564G>T	ESP,TOPMed
RCV000688951	p.Val912Phe	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30932558C>A	ClinVar
rs772397976	p.Ile914Ser	missense variant	-	NC_000022.11:g.30932551A>C	ExAC,gnomAD
rs1316632272	p.Leu915Ile	missense variant	-	NC_000022.11:g.30932549G>T	gnomAD
rs1305351282	p.Arg916Trp	missense variant	-	NC_000022.11:g.30932546G>A	gnomAD
rs974685925	p.Arg916Gln	missense variant	-	NC_000022.11:g.30932545C>T	TOPMed
rs767914603	p.Cys918Trp	missense variant	-	NC_000022.11:g.30932446A>C	ExAC,TOPMed,gnomAD
rs762057484	p.Arg920Gln	missense variant	-	NC_000022.11:g.30932441C>T	ExAC,gnomAD
rs768569356	p.Ser926Gly	missense variant	-	NC_000022.11:g.30932424T>C	ExAC,TOPMed,gnomAD
rs1341365393	p.Ser930Tyr	missense variant	-	NC_000022.11:g.30932411G>T	TOPMed
rs1290632259	p.Lys932Gln	missense variant	-	NC_000022.11:g.30932406T>G	gnomAD
rs749832228	p.Ala936Thr	missense variant	-	NC_000022.11:g.30932394C>T	ExAC,gnomAD
rs1349107983	p.Asn938Ser	missense variant	-	NC_000022.11:g.30932387T>C	TOPMed,gnomAD
rs775910270	p.Asp940His	missense variant	-	NC_000022.11:g.30932382C>G	ExAC
COSM4769926	p.Leu942Val	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000022.11:g.30932376G>C	NCI-TCGA Cosmic
COSM4929865	p.Ile943Met	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000022.11:g.30932371T>C	NCI-TCGA Cosmic
rs770321874	p.Ile943Thr	missense variant	-	NC_000022.11:g.30932372A>G	ExAC,gnomAD
rs1162268371	p.Ile943Val	missense variant	-	NC_000022.11:g.30932373T>C	TOPMed,gnomAD
NCI-TCGA novel	p.Ser944Tyr	missense variant	-	NC_000022.11:g.30932369G>T	NCI-TCGA
rs1235246986	p.Ser944Cys	missense variant	-	NC_000022.11:g.30932369G>C	gnomAD
NCI-TCGA novel	p.Pro946Ser	missense variant	-	NC_000022.11:g.30932364G>A	NCI-TCGA
rs1417889591	p.Pro946Leu	missense variant	-	NC_000022.11:g.30932363G>A	gnomAD
rs1285225047	p.Glu949Asp	missense variant	-	NC_000022.11:g.30928202C>A	TOPMed
NCI-TCGA novel	p.Leu958Ile	missense variant	-	NC_000022.11:g.30928177G>T	NCI-TCGA
rs750335952	p.Asn960Lys	missense variant	-	NC_000022.11:g.30928169G>C	ExAC,TOPMed,gnomAD
RCV000658935	p.Asn963Ser	missense variant	-	NC_000022.11:g.30928161T>C	ClinVar
rs781162787	p.Asn963Ser	missense variant	-	NC_000022.11:g.30928161T>C	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Gln966His	missense variant	-	NC_000022.11:g.30928151C>G	NCI-TCGA
rs757157506	p.Ser967Asn	missense variant	-	NC_000022.11:g.30928149C>T	ExAC,TOPMed,gnomAD
rs370918395	p.Arg968His	missense variant	-	NC_000022.11:g.30928146C>T	ESP,ExAC,gnomAD
rs764290080	p.Arg968Cys	missense variant	-	NC_000022.11:g.30928147G>A	ExAC,TOPMed,gnomAD
NCI-TCGA novel	p.Asp970Glu	missense variant	-	NC_000022.11:g.30928139G>T	NCI-TCGA
rs1252988467	p.Asp970Asn	missense variant	-	NC_000022.11:g.30928141C>T	gnomAD
COSM4861331	p.Ser971Phe	missense variant	Variant assessed as Somatic; MODERATE impact.	NC_000022.11:g.30928137G>A	NCI-TCGA Cosmic
rs142559213	p.Ser971Cys	missense variant	-	NC_000022.11:g.30928137G>C	1000Genomes
rs1278082078	p.Arg972Gln	missense variant	-	NC_000022.11:g.30928134C>T	TOPMed,gnomAD
RCV000548906	p.Arg972Trp	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30928135G>A	ClinVar
rs1485425350	p.Arg972Trp	missense variant	-	NC_000022.11:g.30928135G>A	gnomAD
rs1236422279	p.Ala973Thr	missense variant	-	NC_000022.11:g.30928132C>T	gnomAD
rs1479285921	p.Ser976Thr	missense variant	-	NC_000022.11:g.30928123A>T	TOPMed,gnomAD
rs777166169	p.Glu977Lys	missense variant	-	NC_000022.11:g.30928120C>T	ExAC,TOPMed,gnomAD
rs1337135631	p.Glu978Asp	missense variant	-	NC_000022.11:g.30928115T>G	gnomAD
rs1307310663	p.Arg981Cys	missense variant	-	NC_000022.11:g.30928108G>A	gnomAD
rs901120411	p.Arg981His	missense variant	-	NC_000022.11:g.30928107C>T	TOPMed,gnomAD
RCV000526856	p.Thr982Ala	missense variant	Charcot-Marie-Tooth disease, axonal, type 2z (CMT2Z)	NC_000022.11:g.30928105T>C	ClinVar
rs771410096	p.Thr982Ala	missense variant	-	NC_000022.11:g.30928105T>C	ExAC,TOPMed,gnomAD
rs773617883	p.Glu984Lys	missense variant	-	NC_000022.11:g.30928099C>T	ExAC,TOPMed,gnomAD
rs748910060	p.Arg988Cys	missense variant	-	NC_000022.11:g.30928087G>A	ExAC,TOPMed,gnomAD
rs747693260	p.Arg988His	missense variant	-	NC_000022.11:g.30928086C>T	ExAC,TOPMed,gnomAD
rs745339848	p.Thr990Met	missense variant	-	NC_000022.11:g.30928080G>A	ExAC,TOPMed,gnomAD
rs1235978797	p.Glu991Asp	missense variant	-	NC_000022.11:g.30928076C>A	TOPMed
rs949572717	p.Lys996Asn	missense variant	-	NC_000022.11:g.30928061C>G	gnomAD
rs778221935	p.Val1002Leu	missense variant	-	NC_000022.11:g.30928045C>A	ExAC,TOPMed,gnomAD
rs778221935	p.Val1002Met	missense variant	-	NC_000022.11:g.30928045C>T	ExAC,TOPMed,gnomAD
rs752921354	p.Ala1003Val	missense variant	-	NC_000022.11:g.30928041G>A	ExAC,TOPMed,gnomAD
rs1202036526	p.Glu1010Gln	missense variant	-	NC_000022.11:g.30928021C>G	TOPMed,gnomAD
rs1342054043	p.Asp1011Asn	missense variant	-	NC_000022.11:g.30926871C>T	gnomAD
rs746468192	p.Thr1016Ala	missense variant	-	NC_000022.11:g.30926856T>C	ExAC,gnomAD
NCI-TCGA novel	p.Asp1017Asn	missense variant	-	NC_000022.11:g.30926853C>T	NCI-TCGA
rs12330040	p.Ala1022Pro	missense variant	-	NC_000022.11:g.30926838C>G	gnomAD
rs12330040	p.Ala1022Thr	missense variant	-	NC_000022.11:g.30926838C>T	gnomAD
rs1353963202	p.Ile1024Asn	missense variant	-	NC_000022.11:g.30926831A>T	gnomAD
rs1353963202	p.Ile1024Thr	missense variant	-	NC_000022.11:g.30926831A>G	gnomAD
rs1187544796	p.Lys1030Thr	missense variant	-	NC_000022.11:g.30926813T>G	TOPMed
rs1173000971	p.Gly1031Glu	missense variant	-	NC_000022.11:g.30926810C>T	gnomAD
rs1452280768	p.Ter1033Trp	stop lost	-	NC_000022.11:g.30926803T>C	gnomAD

Disease or phenotype associated information

Disease ID	Disease Name	Disease Type	Source
C0007959	Charcot-Marie-Tooth Disease	disease	BEFREE;CTD_human;GENOMICS_ENGLAND
C0011053	Deafness	phenotype	HPO
C0015644	Muscular fasciculation	phenotype	HPO
C0018772	Hearing Loss, Partial	phenotype	HPO
C0026821	Muscle Cramp	phenotype	HPO
C0085684	Foot-drop	disease	HPO
C0205713	Roussy-Levy Syndrome (disorder)	disease	CTD_human
C0234132	Pyramidal sign	phenotype	BEFREE
C0241703	High pitched voice	phenotype	HPO
C0270911	Charcot-Marie-Tooth Disease, Type Ia (disorder)	disease	CTD_human
C0270912	Charcot-Marie-Tooth Disease, Type Ib	disease	CTD_human
C0270914	Hereditary Motor and Sensory-Neuropathy Type II	disease	BEFREE;CTD_human
C0311394	Difficulty walking	phenotype	HPO
C0339789	Congenital deafness	disease	HPO
C0442874	Neuropathy	group	BEFREE
C0684219	Myokymia	phenotype	HPO
C0728829	Congenital pes cavus	disease	HPO
C0751036	Hereditary Motor and Sensory Neuropathy Type I	disease	CTD_human
C0950123	Genetic Diseases, Inborn	group	CLINVAR
C1384666	hearing impairment	phenotype	HPO
C1847584	Distal sensory impairment	phenotype	HPO
C1858120	Generalized hypotonia	phenotype	HPO
C1866141	Foot dorsiflexor weakness	phenotype	HPO
C4225243	CHARCOT-MARIE-TOOTH DISEASE, AXONAL, TYPE 2Z	disease	CLINVAR;CTD_human;ORPHANET;UNIPROT

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO ID	GO Term	Evidence
GO:0000287	magnesium ion binding	IDA
GO:0003682	chromatin binding	IDA
GO:0005515	protein binding	IPI
GO:0005524	ATP binding	IDA
GO:0008270	zinc ion binding	IDA
GO:0016887	ATPase activity	IDA
GO:0042803	protein homodimerization activity	IDA

GO:Biological Process

GO ID	GO Term	Evidence
GO:0006338	chromatin remodeling	IDA
GO:0006631	fatty acid metabolic process	IEA
GO:0006974	cellular response to DNA damage stimulus	IDA
GO:0045814	negative regulation of gene expression, epigenetic	IDA
GO:0045869	negative regulation of single stranded viral RNA replication via double stranded DNA intermediate	ISS
GO:0045869	negative regulation of single stranded viral RNA replication via double stranded DNA intermediate	IMP
GO:0090309	positive regulation of methylation-dependent chromatin silencing	IDA

GO:Cellular Component

GO ID	GO Term	Evidence
GO:0000792	heterochromatin	IDA
GO:0005634	nucleus	IBA
GO:0005634	nucleus	IDA
GO:0005654	nucleoplasm	IDA
GO:0005737	cytoplasm	IDA
GO:0005829	cytosol	IDA
GO:0016363	nuclear matrix	IDA

Reactome Pathway

Reactome ID	Reactome Term	Evidence
R-HSA-1430728	Metabolism	TAS
R-HSA-556833	Metabolism of lipids	TAS
R-HSA-75105	Fatty acyl-CoA biosynthesis	TAS
R-HSA-8978868	Fatty acid metabolism	TAS

Drugs and compounds information

ID	Drug Name	Action	PubMed
D015056	1-Methyl-3-isobutylxanthine	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of MORC2 mRNA	28628672
D000082	Acetaminophen	Acetaminophen results in decreased expression of MORC2 mRNA	21420995
D020106	Acrylamide	Acrylamide results in decreased expression of MORC2 mRNA	28959563
D016604	Aflatoxin B1	Aflatoxin B1 results in decreased methylation of MORC2 gene	27153756
D001280	Atrazine	Atrazine results in increased expression of MORC2 mRNA	25929836
D001280	Atrazine	Atrazine results in decreased expression of MORC2 mRNA	22378314
C044887	beta-methylcholine	beta-methylcholine affects the expression of MORC2 mRNA	21179406
C006780	bisphenol A	bisphenol A affects the expression of MORC2 mRNA	21786754
C006780	bisphenol A	bisphenol A results in decreased expression of MORC2 mRNA	25181051
C000611646	bisphenol F	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of MORC2 mRNA	28628672
D000069286	Bortezomib	Bortezomib results in increased expression of MORC2 mRNA	20977926
D002392	Catechin	[Catechin co-treated with Grape Seed Proanthocyanidins] results in increased expression of MORC2 mRNA	24763279
D003907	Dexamethasone	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of MORC2 mRNA	28628672
C000944	dicrotophos	dicrotophos results in increased expression of MORC2 mRNA	28302478
D004317	Doxorubicin	Doxorubicin results in decreased expression of MORC2 mRNA	29803840
D004726	Endosulfan	Endosulfan results in increased expression of MORC2 protein	26615145
D005485	Flutamide	Flutamide results in increased expression of MORC2 mRNA	24793618
D005557	Formaldehyde	Formaldehyde results in decreased expression of MORC2 mRNA	27664576
D012739	Gonadal Steroid Hormones	Gonadal Steroid Hormones results in increased expression of MORC2 mRNA	21453500
C511402	Grape Seed Proanthocyanidins	[Catechin co-treated with Grape Seed Proanthocyanidins] results in increased expression of MORC2 mRNA	24763279
D007213	Indomethacin	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of MORC2 mRNA	28628672
D015759	Ionomycin	[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in increased expression of MORC2 mRNA	25613284
C410337	K 7174	K 7174 results in increased expression of MORC2 mRNA	24086573
D019344	Lactic Acid	Lactic Acid results in decreased expression of MORC2 mRNA	30851411
C000622638	MLN7243	MLN7243 results in decreased sumoylation of MORC2 protein	31285264
D010634	Phenobarbital	Phenobarbital affects the expression of MORC2 mRNA	19159669
D010795	Phthalic Acids	Phthalic Acids results in decreased expression of MORC2 mRNA	21061450
C061133	tamibarotene	tamibarotene results in decreased expression of MORC2 mRNA	15498508
D013755	Tetradecanoylphorbol Acetate	[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in increased expression of MORC2 mRNA	25613284
D013853	Thioacetamide	Thioacetamide results in increased expression of MORC2 mRNA	23411599
D013893	Thiram	Thiram results in decreased expression of MORC2 mRNA	20530235
D014212	Tretinoin	Tretinoin results in decreased expression of MORC2 mRNA	15498508
D014212	Tretinoin	Tretinoin results in increased expression of MORC2 mRNA	20488242
C025643	vinclozolin	vinclozolin results in increased expression of MORC2 mRNA	23034163

Functional annotations

Keywords

Keyword ID	Keyword Term
KW-0002	3D-structure
KW-0007	Acetylation
KW-0025	Alternative splicing
KW-0067	ATP-binding
KW-0144	Charcot-Marie-Tooth disease
KW-0158	Chromosome
KW-0175	Coiled coil
KW-0963	Cytoplasm
KW-0225	Disease mutation
KW-0276	Fatty acid metabolism
KW-0378	Hydrolase
KW-1017	Isopeptide bond
KW-0443	Lipid metabolism
KW-0460	Magnesium
KW-0479	Metal-binding
KW-0523	Neurodegeneration
KW-0622	Neuropathy
KW-0547	Nucleotide-binding
KW-0539	Nucleus
KW-0597	Phosphoprotein
KW-0621	Polymorphism
KW-1185	Reference proteome
KW-0832	Ubl conjugation
KW-0862	Zinc
KW-0863	Zinc-finger

Interpro

InterPro ID	InterPro Term
IPR036890	HATPase_C_sf
IPR041006	Morc_S5
IPR011124	Znf_CW

PROSITE

PROSITE ID	PROSITE Term
PS51050	ZF_CW

Pfam

Pfam ID	Pfam Term
PF17942	Morc6_S5
PF07496	zf-CW

Gene: MORC2

Basic information

Gene expression in different tissues (ENCODE)

Protein structural annotations

3D structure in PDB database

Protein disorder information

Orthologous information

Other genetic variants/mutations

Disease or phenotype associated information

Gene Ontology (GO)/biological pathways

GO:Molecular Function

GO:Biological Process

GO:Cellular Component

Reactome Pathway

Drugs and compounds information

Functional annotations

Keywords

Interpro

PROSITE

Pfam

Protein-protein interaction

Protein-miRNA interaction