| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406882 |
Name | MIRLET7A2 |
Synonym | LET7A2|MIRNLET7A2|let-7a-2;microRNA let-7a-2;MIRLET7A2;microRNA let-7a-2 |
Definition | - |
Position | 11q24.1 |
Gene Type | miscRNA |
PAH Type | Description |
PH | "Table 1, complied list of hypoxamirs with functions in PH that have been experimentally established or highly suspected." |
| More detail of all Human literatures about MIRLET7A2 | |
External Links | |
Links to Entrez Gene | 406882 |
Links to all GeneRIF Items | 406882 |
Links to iHOP | 406882 |
Sequence Information | |
Nucleotide Sequence | >406882 : length: 22 tgaggtagtaggttgtatagtt |
Protein Sequence | >406882 : length: 3 N/A |