| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406883 |
Name | MIRLET7A3 |
Synonym | LET7A3|MIRNLET7A3|let-7a-3;microRNA let-7a-3;MIRLET7A3;microRNA let-7a-3 |
Definition | - |
Position | 22q13.31 |
Gene Type | miscRNA |
|
PAH Type |
Description |
PH | "Table 1, complied list of hypoxamirs with functions in PH that have been experimentally established or highly suspected." |
| More detail of all Human literatures about MIRLET7A3 | |
|
External Links |
|
Links to Entrez Gene | 406883 |
Links to all GeneRIF Items | 406883 |
Links to iHOP | 406883 |
|
Sequence Information |
|
Nucleotide Sequence |
>406883 : length: 22 tgaggtagtaggttgtatagtt |
Protein Sequence |
>406883 : length: 3 N/A |