| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406884 |
Name | MIRLET7B |
Synonym | LET7B|MIRNLET7B|hsa-let-7b|let-7b;microRNA let-7b;MIRLET7B;microRNA let-7b |
Definition | - |
Position | 22q13.31 |
Gene Type | miscRNA |
PAH Type | Description |
PH | "Table 1, complied list of hypoxamirs with functions in PH that have been experimentally established or highly suspected." |
| More detail of all Human literatures about MIRLET7B | |
External Links | |
Links to Entrez Gene | 406884 |
Links to all GeneRIF Items | 406884 |
Links to iHOP | 406884 |
Sequence Information | |
Nucleotide Sequence | >406884 : length: 22 tgaggtagtaggttgtgtggtt |
Protein Sequence | >406884 : length: 3 N/A |