| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406885 |
Name | MIRLET7C |
Synonym | LET7C|MIRNLET7C|hsa-let-7c|let-7c;microRNA let-7c;MIRLET7C;microRNA let-7c |
Definition | - |
Position | 21q21.1 |
Gene Type | miscRNA |
|
PAH Type |
Description |
PH | "Table 1, complied list of hypoxamirs with functions in PH that have been experimentally established or highly suspected." |
| More detail of all Human literatures about MIRLET7C | |
|
External Links |
|
Links to Entrez Gene | 406885 |
Links to all GeneRIF Items | 406885 |
Links to iHOP | 406885 |
|
Sequence Information |
|
Nucleotide Sequence |
>406885 : length: 22 tgaggtagtaggttgtatggtt |
Protein Sequence |
>406885 : length: 3 N/A |