| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406887 |
Name | MIRLET7E |
Synonym | MIRNLET7E|hsa-let-7e|let-7e;microRNA let-7e;MIRLET7E;microRNA let-7e |
Definition | - |
Position | 19q13.41 |
Gene Type | miscRNA |
PAH Type | Description |
PH | "Table 1, complied list of hypoxamirs with functions in PH that have been experimentally established or highly suspected." |
| More detail of all Human literatures about MIRLET7E | |
External Links | |
Links to Entrez Gene | 406887 |
Links to all GeneRIF Items | 406887 |
Links to iHOP | 406887 |
Sequence Information | |
Nucleotide Sequence | >406887 : length: 22 tgaggtaggaggttgtatagtt |
Protein Sequence | >406887 : length: 3 N/A |