| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406888 |
Name | MIRLET7F1 |
Synonym | LET7F1|MIRNLET7F1|let-7f-1;microRNA let-7f-1;MIRLET7F1;microRNA let-7f-1 |
Definition | - |
Position | 9q22.32 |
Gene Type | miscRNA |
|
PAH Type |
Description |
PH | "Table 1, complied list of hypoxamirs with functions in PH that have been experimentally established or highly suspected." |
| More detail of all Human literatures about MIRLET7F1 | |
|
External Links |
|
Links to Entrez Gene | 406888 |
Links to all GeneRIF Items | 406888 |
Links to iHOP | 406888 |
|
Sequence Information |
|
Nucleotide Sequence |
>406888 : length: 22 tgaggtagtagattgtatagtt |
Protein Sequence |
>406888 : length: 3 N/A |