| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406888 |
Name | MIRLET7F1 |
Synonym | LET7F1|MIRNLET7F1|let-7f-1;microRNA let-7f-1;MIRLET7F1;microRNA let-7f-1 |
Definition | - |
Position | 9q22.32 |
Gene Type | miscRNA |
PAH Type | Description |
PH | "Table 1, complied list of hypoxamirs with functions in PH that have been experimentally established or highly suspected." |
| More detail of all Human literatures about MIRLET7F1 | |
External Links | |
Links to Entrez Gene | 406888 |
Links to all GeneRIF Items | 406888 |
Links to iHOP | 406888 |
Sequence Information | |
Nucleotide Sequence | >406888 : length: 22 tgaggtagtagattgtatagtt |
Protein Sequence | >406888 : length: 3 N/A |