| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406890 |
Name | MIRLET7G |
Synonym | LET7G|MIRNLET7G|hsa-let-7g;microRNA let-7g;MIRLET7G;microRNA let-7g |
Definition | - |
Position | 3p21.1 |
Gene Type | miscRNA |
PAH Type | Description |
PH | "Table 1, complied list of hypoxamirs with functions in PH that have been experimentally established or highly suspected." |
| More detail of all Human literatures about MIRLET7G | |
External Links | |
Links to Entrez Gene | 406890 |
Links to all GeneRIF Items | 406890 |
Links to iHOP | 406890 |
Sequence Information | |
Nucleotide Sequence | >406890 : length: 22 tgaggtagtagtttgtacagtt |
Protein Sequence | >406890 : length: 3 N/A |