General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information |
|
---|---|
Gene ID | 406919 |
Name | MIR130A |
Synonym | MIRN130A|miRNA130A;microRNA 130a;MIR130A;microRNA 130a |
Definition | - |
Position | 11q12.1 |
Gene Type | miscRNA |
PAH Type |
Description |
PH | "Table 1, complied list of hypoxamirs with functions in PH that have been experimentally established or highly suspected." |
More detail of all Human literatures about MIR130A | |
External Links |
|
Links to Entrez Gene | 406919 |
Links to all GeneRIF Items | 406919 |
Links to iHOP | 406919 |
Sequence Information |
|
Nucleotide Sequence |
>406919 : length: 22 ttcacattgtgctactgtctgc |
Protein Sequence |
>406919 : length: 3 N/A |