| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406937 |
Name | MIR145 |
Synonym | MIRN145|miR-145|miRNA145;microRNA 145;MIR145;microRNA 145 |
Definition | - |
Position | 5q32 |
Gene Type | miscRNA |
|
PAH Type |
Description |
PAH | miR-145 is dysregulated in mouse models of pulmonary arterial hypertension (PAH). Downregulation of miR-145 protects against the development of PAH. |
PAH | miR-145 is dysregulated in mouse models of pulmonary arterial hypertension (PAH). Downregulation of miR-145 protects against the development of PAH. |
PH | "Table 1, complied list of hypoxamirs with functions in PH that have been experimentally established or highly suspected." |
| More detail of all Mouse literatures about MIR145 | |
|
External Links |
|
Links to Entrez Gene | 406937 |
Links to all GeneRIF Items | 406937 |
Links to iHOP | 406937 |
|
Sequence Information |
|
Nucleotide Sequence |
>406937 : length: 23 gtccagttttcccaggaatccct |
Protein Sequence |
>406937 : length: 3 N/A |