| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406952 |
Name | MIR17 |
Synonym | MIR17-5p|MIR91|MIRN17|MIRN91|hsa-mir-17|miR-17|miR17-3p|miRNA17|miRNA91;microRNA 17;MIR17;microRNA 17 |
Definition | - |
Position | 13q31.3 |
Gene Type | miscRNA |
|
PAH Type |
Description |
PAH | "Table 1, complied list of hypoxamirs with functions in PH that have been experimentally established or highly suspected." |
| More detail of all Human literatures about MIR17 | |
|
External Links |
|
Links to Entrez Gene | 406952 |
Links to all GeneRIF Items | 406952 |
Links to iHOP | 406952 |
|
Sequence Information |
|
Nucleotide Sequence |
>406952 : length: 23 caaagtgcttacagtgcaggtag |
Protein Sequence |
>406952 : length: 3 N/A |