| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406987 |
Name | MIR204 |
Synonym | MIRN204|miRNA204;microRNA 204;MIR204;microRNA 204 |
Definition | - |
Position | 9q21.12 |
Gene Type | miscRNA |
PAH Type | Description |
PAH | Role for miR-204 in human pulmonary arterial hypertension. |
PAH | "Table 1, complied list of hypoxamirs with functions in PH that have been experimentally established or highly suspected." |
PAH | "Recently, it was shown that miR-204 is reduced in PAH, and low miR-204 increases the level of phosphatase Shp2, which in turn activates NFATc2." |
| More detail of all Human literatures about MIR204 | |
External Links | |
Links to Entrez Gene | 406987 |
Links to all GeneRIF Items | 406987 |
Links to iHOP | 406987 |
Sequence Information | |
Nucleotide Sequence | >406987 : length: 22 ttccctttgtcatcctatgcct |
Protein Sequence | >406987 : length: 3 N/A |