| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406992 |
Name | MIR210 |
Synonym | MIRN210|mir-210;microRNA 210;MIR210;microRNA 210 |
Definition | - |
Position | 11p15.5 |
Gene Type | miscRNA |
|
PAH Type |
Description |
PH | "Table 1, complied list of hypoxamirs with functions in PH that have been experimentally established or highly suspected." |
| More detail of all Human literatures about MIR210 | |
|
External Links |
|
Links to Entrez Gene | 406992 |
Links to all GeneRIF Items | 406992 |
Links to iHOP | 406992 |
|
Sequence Information |
|
Nucleotide Sequence |
>406992 : length: 22 ctgtgcgtgtgacagcggctga |
Protein Sequence |
>406992 : length: 3 N/A |