| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 407009 |
Name | MIR224 |
Synonym | MIRN224|miRNA224;microRNA 224;MIR224;microRNA 224 |
Definition | - |
Position | Xq28 |
Gene Type | miscRNA |
PAH Type | Description |
PH | "Table 1, complied list of hypoxamirs with functions in PH that have been experimentally established or highly suspected." |
| More detail of all Human literatures about MIR224 | |
External Links | |
Links to Entrez Gene | 407009 |
Links to all GeneRIF Items | 407009 |
Links to iHOP | 407009 |
Sequence Information | |
Nucleotide Sequence | >407009 : length: 21 caagtcactagtggttccgtt |
Protein Sequence | >407009 : length: 3 N/A |