| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407018 |
Name | MIR27A |
Synonym | MIR27|MIRN27A;microRNA 27a;MIR27A;microRNA 27a |
Definition | - |
Position | 19p13.13 |
Gene Type | miscRNA |
|
PAH Type |
Description |
PH | "Table 1, complied list of hypoxamirs with functions in PH that have been experimentally established or highly suspected." |
| More detail of all Human literatures about MIR27A | |
|
External Links |
|
Links to Entrez Gene | 407018 |
Links to all GeneRIF Items | 407018 |
Links to iHOP | 407018 |
|
Sequence Information |
|
Nucleotide Sequence |
>407018 : length: 22 agggcttagctgcttgtgagca |
Protein Sequence |
>407018 : length: 3 N/A |