| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407019 |
Name | MIR27B |
Synonym | MIR-27b|MIRN27B|miRNA27B;microRNA 27b;MIR27B;microRNA 27b |
Definition | - |
Position | 9q22.32 |
Gene Type | miscRNA |
|
PAH Type |
Description |
PH | "Table 1, complied list of hypoxamirs with functions in PH that have been experimentally established or highly suspected." |
| More detail of all Human literatures about MIR27B | |
|
External Links |
|
Links to Entrez Gene | 407019 |
Links to all GeneRIF Items | 407019 |
Links to iHOP | 407019 |
|
Sequence Information |
|
Nucleotide Sequence |
>407019 : length: 22 agagcttagctgattggtgaac |
Protein Sequence |
>407019 : length: 3 N/A |