| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407032 |
Name | MIR30C2 |
Synonym | MIRN30C2;microRNA 30c-2;MIR30C2;microRNA 30c-2 |
Definition | - |
Position | 6q13 |
Gene Type | miscRNA |
|
PAH Type |
Description |
PH | "Table 1, complied list of hypoxamirs with functions in PH that have been experimentally established or highly suspected." |
| More detail of all Human literatures about MIR30C2 | |
|
External Links |
|
Links to Entrez Gene | 407032 |
Links to all GeneRIF Items | 407032 |
Links to iHOP | 407032 |
|
Sequence Information |
|
Nucleotide Sequence |
>407032 : length: 23 tgtaaacatcctacactctcagc |
Protein Sequence |
>407032 : length: 3 N/A |