| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 407032 |
Name | MIR30C2 |
Synonym | MIRN30C2;microRNA 30c-2;MIR30C2;microRNA 30c-2 |
Definition | - |
Position | 6q13 |
Gene Type | miscRNA |
PAH Type | Description |
PH | "Table 1, complied list of hypoxamirs with functions in PH that have been experimentally established or highly suspected." |
| More detail of all Human literatures about MIR30C2 | |
External Links | |
Links to Entrez Gene | 407032 |
Links to all GeneRIF Items | 407032 |
Links to iHOP | 407032 |
Sequence Information | |
Nucleotide Sequence | >407032 : length: 23 tgtaaacatcctacactctcagc |
Protein Sequence | >407032 : length: 3 N/A |