| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 442901 |
Name | MIR328 |
Synonym | MIRN328|hsa-mir-328;microRNA 328;MIR328;microRNA 328 |
Definition | - |
Position | 16q22.1 |
Gene Type | miscRNA |
PAH Type | Description |
HPH | "Here we show that miRNA-328, a posttranscriptional regulator, was drastically downregulated in the pulmonary artery (PA) after a hypoxic assault". |
| More detail of all Human literatures about MIR328 | |
External Links | |
Links to Entrez Gene | 442901 |
Links to all GeneRIF Items | 442901 |
Links to iHOP | 442901 |
Sequence Information | |
Nucleotide Sequence | >442901 : length: 22 ctggccctctctgcccttccgt |
Protein Sequence | >442901 : length: 3 N/A |