| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 494336 |
Name | MIR424 |
Synonym | MIR322|MIRN424|hsa-mir-424|miRNA424;microRNA 424;MIR424;microRNA 424 |
Definition | - |
Position | Xq26.3 |
Gene Type | miscRNA |
|
PAH Type |
Description |
PAH | "miR-424 was downregulated in pulmonary arterial hypertension, exerted antiproliferative effects in pulmonary artery endothelial cells". |
| More detail of all Human literatures about MIR424 | |
|
External Links |
|
Links to Entrez Gene | 494336 |
Links to all GeneRIF Items | 494336 |
Links to iHOP | 494336 |
|
Sequence Information |
|
Nucleotide Sequence |
>494336 : length: 22 cagcagcaattcatgttttgaa |
Protein Sequence |
>494336 : length: 3 N/A |