| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 574411 |
Name | MIR451A |
Synonym | MIR451|MIRN451|hsa-mir-451|hsa-mir-451a;microRNA 451a;MIR451A;microRNA 451a |
Definition | - |
Position | 17q11.2 |
Gene Type | miscRNA |
|
PAH Type |
Description |
PH | "Table 1, complied list of hypoxamirs with functions in PH that have been experimentally established or highly suspected." |
| More detail of all Human literatures about MIR451A | |
|
External Links |
|
Links to Entrez Gene | 574411 |
Links to all GeneRIF Items | 574411 |
Links to iHOP | 574411 |
|
Sequence Information |
|
Nucleotide Sequence |
>574411 : length: 22 aaaccgttaccattactgagtt |
Protein Sequence |
>574411 : length: 3 N/A |