| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 100126299 |
Name | VTRNA2-1 |
Synonym | CBL-3|CBL3|MIR886|MIRN886|VTRNA2|hsa-mir-886|hvg-5|nc886;vault RNA 2-1;VTRNA2-1;vault RNA 2-1 |
Definition | microRNA 886|vault RNA 2 |
Position | 5q31.1 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 100126299 |
Links to all GeneRIF Items | 100126299 |
Links to iHOP | 100126299 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>100126299 : length: 100 gggtcggagttagctcaagcggttacctcctcatgccggactttctatctgtccatctct gtgctggggttcgagacccgcgggtgcttactgacccttt |
Protein Sequence |
>100126299 : length: 3 N/A |