| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 100126306 |
Name | MIR888 |
Synonym | MIRN888|hsa-mir-888;microRNA 888;MIR888;microRNA 888 |
Definition | - |
Position | Xq27.3 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 100126306 |
Links to all GeneRIF Items | 100126306 |
Links to iHOP | 100126306 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>100126306 : length: 21 tactcaaaaagctgtcagtca |
Protein Sequence |
>100126306 : length: 3 N/A |