| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 100126337 |
Name | MIR509-3 |
Synonym | MIRN509-3;microRNA 509-3;MIR509-3;microRNA 509-3 |
Definition | hsa-mir-509-3 |
Position | - |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 100126337 |
Links to all GeneRIF Items | 100126337 |
Links to iHOP | 100126337 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>100126337 : length: 22 tactgcagacgtggcaatcatg |
Protein Sequence |
>100126337 : length: 3 N/A |