| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 100302221 |
Name | MIR1291 |
Synonym | MIRN1291|hsa-mir-1291;microRNA 1291;MIR1291;microRNA 1291 |
Definition | - |
Position | - |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 100302221 |
Links to all GeneRIF Items | 100302221 |
Links to iHOP | 100302221 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >100302221 : length: 24 tggccctgactgaagaccagcagt |
Protein Sequence | >100302221 : length: 3 N/A |