| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 103344718 |
Name | HOTS |
Synonym | -;H19 Opposite Tumor Suppressor;-;- |
Definition | - |
Position | - |
Gene Type | protein-coding |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 103344718 |
Links to all GeneRIF Items | 103344718 |
Links to iHOP | 103344718 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>103344718 : length: 484 tgctgtaacagtgtttattgatgatgagtccagggctcctgctgaagccctggtggggag gggcacagagcgagatggggcgtaatggaatgcttgaaggctgctccgtgatgtcggtcg gagcttccagactaggcgagggcagggtgaggcctcgggcacacagccggcgcccagtca cccggcccagatggagggcggccgggccctgcacaggcacttgccaaggtggctcacact cacgcacactcgtactgagactcaaggccgtctccacaactccaaccagtgcaaatgact tagtgcaaattaaattcagaagggacgggggaaacagagtcgtggaggctttgaatctct cagaaaaaaggaaagacaggaaagctcagaaacaaagagacagaaggatgaaaaagaaga agagggaggtggtggggacggcgtcatcccgctggaggagctcagctctgggatgatgtg gtgg |
Protein Sequence |
>103344718 : length: 3 N/A |