| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 326343 |
Name | MT1DP |
Synonym | MTM;metallothionein 1D, pseudogene (functional);MT1DP;metallothionein 1D, pseudogene (functional) |
Definition | metallothionein 1A pseudogene|metallothionein 1D (pseudogene)|metallothionein M |
Position | 16q13 |
Gene Type | pseudo |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 326343 |
Links to all GeneRIF Items | 326343 |
Links to iHOP | 326343 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>326343 : length: 503 atagaacatccctggggcaggaggcaggtgcattttgagctcttcctaaagtggactcct ttgctttgcacttctcgagctttctccccgccaagagccttcatcaccacttagaacatt gccatcttcctagtgcctccgatttctgaggcgagaggactgaggctgaaaactgcccgg ctgcaggtcaccctcaaggccaaaggtggctcctgcacctgtgccagctcctgcaaatgc aaagagtacaaatgcacctcctgcaagaagaactgctgctcctgctgccccatgggctgt gccaaatgtgcccagggctgcacctgaaaaggggcattggagaagtgcagctgccgtgcc tgatgttgggacagccctgcgtccagttgtaaataacgcaacccctacaaatctagtttt tttttaaacacaaacctaacccatttactatgtctgttttcttaaatgaaatatgggaat gataataaacattgttggcctta |
Protein Sequence |
>326343 : length: 3 N/A |