| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 347745 |
Name | PWAR4 |
Synonym | PAR-4|PAR4;Prader Willi/Angelman region RNA 4;PWAR4;Prader Willi/Angelman region RNA 4 |
Definition | Prader-Willi/Angelman region gene 4 |
Position | 15q11.2 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 347745 |
Links to all GeneRIF Items | 347745 |
Links to iHOP | 347745 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>347745 : length: 342 gaagctcaggcccttcctggccccttgatctcctgcactgagctgtggtgagcacatccg ggtcccgctggatgtatgtgtgggcagggggggtgccctgggttgggtcaatgatgagaa ccctatattgtgttgaagagaggtgatgacttaaaattaccatgctcaatgattacgctg aggcccaacctaggtgagaaatttggaggaggatgctgggatcccgagatttccggcagg gccactgtattttgggctggagccctggaggccctgaaaggtatctggaggaggcccaac tctgtctctgcactcctctgtgaggcagcccaggctccctgt |
Protein Sequence |
>347745 : length: 3 N/A |