| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406882 |
Name | MIRLET7A2 |
Synonym | LET7A2|MIRNLET7A2|let-7a-2;microRNA let-7a-2;MIRLET7A2;microRNA let-7a-2 |
Definition | hsa-let-7a-2 |
Position | 11q24.1 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 406882 |
Links to all GeneRIF Items | 406882 |
Links to iHOP | 406882 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406882 : length: 22 tgaggtagtaggttgtatagtt |
Protein Sequence |
>406882 : length: 3 N/A |