| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406883 |
Name | MIRLET7A3 |
Synonym | LET7A3|MIRNLET7A3|let-7a-3;microRNA let-7a-3;MIRLET7A3;microRNA let-7a-3 |
Definition | hsa-let-7a-3 |
Position | 22q13.31 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 406883 |
Links to all GeneRIF Items | 406883 |
Links to iHOP | 406883 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406883 : length: 22 tgaggtagtaggttgtatagtt |
Protein Sequence |
>406883 : length: 3 N/A |