| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406884 |
Name | MIRLET7B |
Synonym | LET7B|MIRNLET7B|hsa-let-7b|let-7b;microRNA let-7b;MIRLET7B;microRNA let-7b |
Definition | - |
Position | 22q13.31 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 406884 |
Links to all GeneRIF Items | 406884 |
Links to iHOP | 406884 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406884 : length: 22 tgaggtagtaggttgtgtggtt |
Protein Sequence | >406884 : length: 3 N/A |