| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406886 |
Name | MIRLET7D |
Synonym | LET7D|MIRNLET7D|hsa-let-7d|let-7d;microRNA let-7d;MIRLET7D;microRNA let-7d |
Definition | - |
Position | 9q22.32 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 406886 |
Links to all GeneRIF Items | 406886 |
Links to iHOP | 406886 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406886 : length: 22 agaggtagtaggttgcatagtt |
Protein Sequence |
>406886 : length: 3 N/A |