| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406888 |
Name | MIRLET7F1 |
Synonym | LET7F1|MIRNLET7F1|let-7f-1;microRNA let-7f-1;MIRLET7F1;microRNA let-7f-1 |
Definition | hsa-let-7f-1 |
Position | 9q22.32 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 406888 |
Links to all GeneRIF Items | 406888 |
Links to iHOP | 406888 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406888 : length: 22 tgaggtagtagattgtatagtt |
Protein Sequence | >406888 : length: 3 N/A |