| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406889 |
Name | MIRLET7F2 |
Synonym | LET7F2|MIRNLET7F2|let-7f-2;microRNA let-7f-2;MIRLET7F2;microRNA let-7f-2 |
Definition | hsa-let-7f-2 |
Position | Xp11.22 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 406889 |
Links to all GeneRIF Items | 406889 |
Links to iHOP | 406889 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406889 : length: 22 tgaggtagtagattgtatagtt |
Protein Sequence |
>406889 : length: 3 N/A |