| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406890 |
Name | MIRLET7G |
Synonym | LET7G|MIRNLET7G|hsa-let-7g;microRNA let-7g;MIRLET7G;microRNA let-7g |
Definition | - |
Position | 3p21.1 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 406890 |
Links to all GeneRIF Items | 406890 |
Links to iHOP | 406890 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406890 : length: 22 tgaggtagtagtttgtacagtt |
Protein Sequence | >406890 : length: 3 N/A |