| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406891 |
Name | MIRLET7I |
Synonym | LET7I|MIRNLET7I|hsa-let-7i;microRNA let-7i;MIRLET7I;microRNA let-7i |
Definition | - |
Position | 12q14.1 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 406891 |
Links to all GeneRIF Items | 406891 |
Links to iHOP | 406891 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406891 : length: 22 tgaggtagtagtttgtgctgtt |
Protein Sequence | >406891 : length: 3 N/A |