| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406899 |
Name | MIR106A |
Synonym | MIRN106A|mir-106;microRNA 106a;MIR106A;microRNA 106a |
Definition | hsa-mir-106a |
Position | Xq26.2 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
| Caution | This gene might be oncogene according to our integrated oncogene list. |
External Links | |
Links to Entrez Gene | 406899 |
Links to all GeneRIF Items | 406899 |
Links to iHOP | 406899 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406899 : length: 23 aaaagtgcttacagtgcaggtag |
Protein Sequence | >406899 : length: 3 N/A |