| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406901 |
Name | MIR107 |
Synonym | MIRN107|miR-107;microRNA 107;MIR107;microRNA 107 |
Definition | hsa-mir-107 |
Position | 10q23.31 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
| Caution | This gene might be oncogene according to our integrated oncogene list. |
|
External Links |
|
Links to Entrez Gene | 406901 |
Links to all GeneRIF Items | 406901 |
Links to iHOP | 406901 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406901 : length: 23 agcagcattgtacagggctatca |
Protein Sequence |
>406901 : length: 3 N/A |