General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information |
|
---|---|
Gene ID | 406902 |
Name | MIR10A |
Synonym | MIRN10A|hsa-mir-10a|miRNA10A|mir-10a;microRNA 10a;MIR10A;microRNA 10a |
Definition | - |
Position | 17q21.32 |
Gene Type | ncRNA |
TSG scores |
Description |
TUSON ranking | N/A |
TUSON P-value | N/A |
External Links |
|
Links to Entrez Gene | 406902 |
Links to all GeneRIF Items | 406902 |
Links to iHOP | 406902 |
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406902 : length: 23 taccctgtagatccgaatttgtg |
Protein Sequence |
>406902 : length: 3 N/A |