| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406904 |
Name | MIR1-1 |
Synonym | MIRN1-1|hsa-mir-1-1|miRNA1-1;microRNA 1-1;MIR1-1;microRNA 1-1 |
Definition | - |
Position | 20q13.33 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 406904 |
Links to all GeneRIF Items | 406904 |
Links to iHOP | 406904 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406904 : length: 22 tggaatgtaaagaagtatgtat |
Protein Sequence | >406904 : length: 3 N/A |