| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406905 |
Name | MIR1-2 |
Synonym | MIRN1-2|hsa-mir-1-2|miRNA1-2;microRNA 1-2;MIR1-2;microRNA 1-2 |
Definition | - |
Position | 18q11.2 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 406905 |
Links to all GeneRIF Items | 406905 |
Links to iHOP | 406905 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406905 : length: 22 tggaatgtaaagaagtatgtat |
Protein Sequence |
>406905 : length: 3 N/A |