| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406906 |
Name | MIR122 |
Synonym | MIR122A|MIRN122|MIRN122A|hsa-mir-122|miRNA122|miRNA122A;microRNA 122;MIR122;microRNA 122 |
Definition | hsa-mir-122a|microRNA 122a |
Position | 18q21.31 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 406906 |
Links to all GeneRIF Items | 406906 |
Links to iHOP | 406906 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406906 : length: 22 tggagtgtgacaatggtgtttg |
Protein Sequence | >406906 : length: 3 N/A |