| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406907 |
Name | MIR124-1 |
Synonym | MIR124A|MIR124A1|MIRN124-1|MIRN124A1;microRNA 124-1;MIR124-1;microRNA 124-1 |
Definition | hsa-mir-124-1|hsa-mir-124a-1|microRNA 124a-1 |
Position | 8p23.1 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 406907 |
Links to all GeneRIF Items | 406907 |
Links to iHOP | 406907 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406907 : length: 22 cgtgttcacagcggaccttgat |
Protein Sequence |
>406907 : length: 3 N/A |