General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information |
|
---|---|
Gene ID | 406909 |
Name | MIR124-3 |
Synonym | MIRN124-3|MIRN124A3;microRNA 124-3;MIR124-3;microRNA 124-3 |
Definition | hsa-mir-124-3|hsa-mir-124a-3|microRNA 124a-3 |
Position | 20q13.33 |
Gene Type | ncRNA |
TSG scores |
Description |
TUSON ranking | N/A |
TUSON P-value | N/A |
External Links |
|
Links to Entrez Gene | 406909 |
Links to all GeneRIF Items | 406909 |
Links to iHOP | 406909 |
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406909 : length: 22 cgtgttcacagcggaccttgat |
Protein Sequence |
>406909 : length: 3 N/A |