| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406910 |
Name | MIR125A |
Synonym | MIRN125A|miRNA125A;microRNA 125a;MIR125A;microRNA 125a |
Definition | hsa-mir-125a |
Position | 19q13.41 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 406910 |
Links to all GeneRIF Items | 406910 |
Links to iHOP | 406910 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406910 : length: 24 tccctgagaccctttaacctgtga |
Protein Sequence |
>406910 : length: 3 N/A |