| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406911 |
Name | MIR125B1 |
Synonym | MIRN125B1;microRNA 125b-1;MIR125B1;microRNA 125b-1 |
Definition | hsa-mir-125b-1 |
Position | 11q24.1 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
| Caution | This gene might be oncogene according to our integrated oncogene list. |
External Links | |
Links to Entrez Gene | 406911 |
Links to all GeneRIF Items | 406911 |
Links to iHOP | 406911 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406911 : length: 22 tccctgagaccctaacttgtga |
Protein Sequence | >406911 : length: 3 N/A |