| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406919 |
Name | MIR130A |
Synonym | MIRN130A|miRNA130A;microRNA 130a;MIR130A;microRNA 130a |
Definition | hsa-mir-130a |
Position | 11q12.1 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 406919 |
Links to all GeneRIF Items | 406919 |
Links to iHOP | 406919 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406919 : length: 22 ttcacattgtgctactgtctgc |
Protein Sequence | >406919 : length: 3 N/A |